Transcript asmbl_77382

Sequence
Transcript Sequence for observation asmbl_77382 of TGE0001248:
ACTGTCCAATCCGGGCAGGGGGCGAGGCCGGGGGACCGGGCGGGCCTGGGGAGCAGGCACGTGTGGAGGGCGGACCCGCCGGGGGTCGAGGCCTGCCTCTCCGAGAGCTCCTGGCGCGGCCGTCCCGGCCCGGGGCCCCAGGTGCGCTTCCCCTAGAGAGGGATTTTCCGGTCTCGTGGGCAGAGGAACAACCAGGAACTTGGGCTCAGTCTCCACCCCACAGTGGGGCGGATCCGTCCCGGATAAGACCCGCTGTCTGGCCCTGAGTAGGGTGTGACCTCCGCAGCCGCAGAGGAGGAGCGCAGCCCGGCCTCGAAGAACTTCTGCTTGGGTGGCTGAACTCTGATCTTGACCTAGAGTCATGGCCATGGCAACCAAAGGAGGTACTGTCAAAGCTGCTTCAGGATTCAATGCCATGGAAGATGCCCAGACCCTGAGGAAGGCCATGAAAGGGCTCGGCACCGATGAAGACGCCATTATTAGCGTCCTTGCCTACCGCAACACCGCCCAGCGCCAGGAGATCAGGACAGCCTACAAGAGCACCATCGGCAGGGACTTGATAGACGACCTGAAGTCAGAACTGAGTGGCAACTTCGAGCAGGTGATTGTGGGGATGATGACGCCCACGGTGCTGTATGACGTGCAAGAGCTGCGAAGGGCCATGAAGGGAGCCGGCACTGATGAGGGCTGCCTAATTGAGATCCTGGCCTCCCGGACCCCTGAGGAGATCCGGCGCATAAGCCAAACCTACCAGCAGCAATATGGACGGAGCCTTGAAGATGACATTCGCTCTGACACATCGTTCATGTTCCAGCGAGTGCTGGTGTCTCTGTCAGCTGGTGGGAGGGATGAAGGAAATTATCTGGACGATGCTCTCGTGAGACAGGATGCCCAGGACCTGTATGAGGCTGGAGAGAAGAAATGGGGGACAGATGAGGTGAAATTTCTAACTGTTCTCTGTTCCCGGAACCGAAATCACCTGTTGCATGTGTTTGATGAATACAAAAGGATATCACAGAAGGATATTGAACAGAGTATTAAATCTGAAACATCTGGTAGCTTTGAAGATGCTCTGCTGGCTATAGTAAAGTGCATGAGGAACAAATCTGCATATTTTGCTGAAAAGCTCTATAAATCGATGAAGGGCTTGGGCACCGATGATAACACCCTCATCAGAGTGATGGTTTCTCGAGCAGAAATTGACATGTTGGATATCCGGGCACACTTCAAGAGACTCTATGGAAAGTCTCTGTACTCGTTCATCAAGGGTGACACATCTGGAGACTACAGGAAAGTACTGCTTGTTCTCTGTGGAGGAGATGATTAAAATAAAAATCCCAGAAGGACAGGAGGATTCTCAACACTTTGAATTTTTTTAACTTCATTTTTCTACACTGCTATTATCATTATCTCAGAATGCTTATTTCCAATTAAAACGCCTACAGCTGCCTCCTAGAATATAGACTGTCTGTATTATTATTCACCTATAATTAGTCATTATGATGCTTTAAAGCTGTACTTGCATTTCAAAGCTTATAAGATATAAATGGAGATTTTAAAGTAGAAATAAATATGTATTCCATGTTTTTAAAAGATTACTTTCTACTTTGTGTTTCACAGACATTGAATATATTAAATTATTCCATATTTTCTTTTCAGTGAAAAATTTTTTAAATGGAAGACTGTTCTAAAATCACTTTTTTCCCTAATCCAATTTTTAGAGTGGCTAGTAGTTTCTTCATTTGAAATTGTAAGCATCCGGTCAGTAAGAATGCCCATCCAGTTTTCTATATTTCATAGTCAAAGCCTTGAAAGCATCTACAAATCTCTTTTTTTAGGTTTTGTCCATAGCATCAGTTGATCCTTACTAAGTTTTTCATGGGAGACTTCCTTCATCACATCTTATGTTGAAATCACTTTCTGTAGTCAAAGTATACCAAAACCAATTTATCTGAACTAAATTCTAAAGTATGGTTATACAAACCATATACATCTGGTTACCAAACATAAATGCTGAACATTCCATATTATTATAGTTAATGTCTTAATCCAGCTTGCAAGTGAATGGAAAAAAAAATAAGCTTCAAACTAGGTATTCTGGGAATGATGTAATGCTCTGAATTTAGTATGATATAAAGAAAACTTTTTTGTGCTAAAAATACTTTTTAAAATCAATTTTGTTGATTGTAGTAATTTCTATTTGCACTGTGCCTTTCAACTCCAGAAACATTCTGAAGATGTACTTGGATTTAATTAAAAAGTTCACTTTGTAAGAACGTGGAAAAATAATTTTAATTTAAAAATGGTGTTTTTAGGCCGGGGGCGGGG