Transcript asmbl_77381

Sequence
Transcript Sequence for observation asmbl_77381 of TGE0001248:
CGCTGTATGTTCCACCCTTCTGGAGCCATCTTATTTGCGGCCTGGCCTCCTGGCACAAGGGATTCTGGAGGTTGTGGTTTCCGAACGGATCGAGACTGACACCTGAAGGACGCGGCTTAACCGCTTAGCCCCTAGCGGGTCCTGTGGGTTTCCCGACGTCTCCTGGGCTGAAATGGAAGCGAGAAGTGATCGGGAACATTGTGCTGGCAGTTGGATCCGGCTGCACCGAGCGCCAGCCTTGAAATAAGTAAAACCGATGCCCTTCCGCCCCTAACCTCAAAAGCTGCTTTTGCGTCTCGATGTTATTGAGAGCCGGCTCTGCGGTCAGCTCTGAGCTAGGCGCTGTGAGAACGCTCAGTAAGACAGTGTCTCGTCTGGAAATGTACAGGCGAGATTCAAACCGAGAAACTGCCAAAGGTTGTGTGCAGGGCAGATCCTAGGATACCGGAGACCCAGCCCGTTGGCTTGACCTCAAAACTCGGGGGCTTTTCGGCCCATGCTGTCCCTTAATTCCTCCTCCTTTGCTGACGCTGTGGGTGCGCATCAAAGCCTAAACTTCACTAGCTCCCTTGCACACAAGAACACTAACCCTAACCTGACCAGTTATTTATTTTTCACTTCAAGATTCTTCCATTGATACTTACGTTTCCCTGATACCGTCCAAGTGCTGAGGGCGGGGATGGACTGTGTGATTTGCATCTGCCAAATGCAGAAAATTTGGAAGTTCACAGCCTCTTAGTTGGATGCCCCTGTGTCACAGAACACATTTTGGCTATGGGGTGTGATCTGTGTCTGAGGAACAACAAGAAGCTACACGTCATCCACACAGGAGCCAAATCTGGAACTCTGGTCTCAGTTCTTCAGGACTATTTGAGCGAATAATCACTCAACACTGGAGTAAAGGATGTTCTACTAGAAGTCTTATTCTGACTCCTAAAACCACGCTACCGAAAGTGTTGATCCACAAACCAGTGCCAGTGCTTGAACTTTGTTACTGGTCCACAGTTAGGTCCCCTCAGTGATTCCTGTGTGCACCCAGGGTTGAGAACTACTGCATAAGAGGTCCTAGAAGATATCTGGTATGGCCAGAGTACAGAGGGACCGGAGAAGAACTTCTGCTTGGGTGGCTGAACTCTGATCTTGACCTAGAGTCATGGCCATGGCAACCAAAGGAGGTACTGTCAAAGCTGCTTCAGGATTCAATGCCATGGAAGATGCCCAGACCCTGAGGAAGGCCATGAAAGGGCTCGGCACCGATGAAGACGCCATTATTAGCGTCCTTGCCTACCGCAACACCGCCCAGCGCCAGGAGATCAGGACAGCCTACAAGAGCACCATCGGCAGGGACTTGATAGACGACCTGAAGTCAGAACTGAGTGGCAACTTCGAGCAGGTGATTGTGGGGATGATGACGCCCACGGTGCTGTATGACGTGCAAGAGCTGCGAAGGGCCATGAAGGGAGCCGGCACTGATGAGGGCTGCCTAATTGAGATCCTGGCCTCCCGGACCCCTGAGGAGATCCGGCGCATAAGCCAAACCTACCAGCAGCAATATGGACGGAGCCTTGAAGATGACATTCGCTCTGACACATCGTTCATGTTCCAGCGAGTGCTGGTGTCTCTGTCAGCTGGTGGGAGGGATGAAGGAAATTATCTGGACGATGCTCTCGTGAGACAGGATGCCCAGGACCTGTATGAGGCTGGAGAGAAGAAATGGGGGACAGATGAGGTGAAATTTCTAACTGTTCTCTGTTCCCGGAACCGAAATCACCTGTTGCATGTGTTTGATGAATACAAAAGGATATCACAGAAGGATATTGAACAGAGTATTAAATCTGAAACATCTGGTAGCTTTGAAGATGCTCTGCTGGCTATAGTAAAGTGCATGAGGAACAAATCTGCATATTTTGCTGAAAAGCTCTATAAATCGATGAAGGGCTTGGGCACCGATGATAACACCCTCATCAGAGTGATGGTTTCTCGAGCAGAAATTGACATGTTGGATATCCGGGCACACTTCAAGAGACTCTATGGAAAGTCTCTGTACTCGTTCATCAAGGGTGACACATCTGGAGACTACAGGAAAGTACTGCTTGTTCTCTGTGGAGGAGATGATTAAAATAAAAATCCCAGAAGGACAGGAGGATTCTCAACACTTTGAATTTTTTTAACTTCATTTTTCTACACTGCTATTATCATTATCTCAGAATGCTTATTTCCAATTAAAACGCCTACAGCTGCCTCCTAGAATATAGACTGTCTGTATTATTATTCACCTATAATTAGTCATTATGATGCTTTAAAGCTGTACTTGCATTTCAAAGCTTATAAGATATAAATGGAGATTTTAAAGTAGAAATAAATATGTATTCCATGTTTTTAAAAGATTACTTTCTACTTTGTGTTTCACAGACATTGAATATATTAAATTATTCCATATTTTCTTTTCAGTGAAAAATTTTTTAAATGGAAGACTGTTCTAAAATCACTTTTTTCCCTAATCCAATTTTTAGAGTGGCTAGTAGTTTCTTCATTTGAAATTGTAAGCATCCGGTCAGTAAGAATGCCCATCCAGTTTTCTATATTTCATAGTCAAAGCCTTGAAAGCATCTACAAATCTCTTTTTTTAGGTTTTGTCCATAGCATCAGTTGATCCTTACTAAGTTTTTCATGGGAGACTTCCTTCATCACATCTTATGTTGAAATCACTTTCTGTAGTCAAAGTATACCAAAACCAATTTATCTGAACTAAATTCTAAAGTATGGTTATACAAACCATATACATCTGGTTACCAAACATAAATGCTGAACATTCCATATTATTATAGTTAATGTCTTAATCCAGCTTGCAAGTGAATGGAAAAAAAAATAAGCTTCAAACTAGGTATTCTGGGAATGATGTAATGCTCTGAATTTAGTATGATATAAAGAAAACTTTTTTGTGCTAAAAATACTTTTTAAAATCAATTTTGTTGATTGTAGTAATTTCTATTTGCACTGTGCCTTTCAACTCCAGAAACATTCTGAAGATGTACTTGGATTTAATTAAAAAGTTCACTTTGTAAGAACGTGGAAAAATAATTTTAATTTAAAAATGGTGTTTTTAGGCCGGGGGCGGGG