Transcript asmbl_77380

Sequence
Transcript Sequence for observation asmbl_77380 of TGE0001248:
CGCTGTATGTTCCACCCTTCTGGAGCCATCTTATTTGCGGCCTGGCCTCCTGGCACAAGGGATTCTGGAGGTTGTGGTTTCCGAACGGATCGAGACTGACACCTGAAGGACGCGGCTTAACCGCTTAGCCCCTAGCGGGTCCTGTGGGTTTCCCGACGTCTCCTGGGCTGAAATGGAAGCGAGAAGTGATCGGGAACATTGTGCTGGCAGTTGGATCCGGCTGCACCGAGCGCCAGCCTTGAAATAATTCACAGCCTCTTAGTTGGATGCCCCTGTGTCACAGAACACATTTTGGCTATGGGGTGTGATCTGTGTCTGAGGAACAACAAGAAGCTACACGTCATCCACACAGGAGCCAAATCTGGAACTCTGGTCTCAGTTCTTCAGGACTATTTGAGCGAATAATCACTCAACACTGGAGTAAAGGATGTTCTACTAGAAGTCTTATTCTGACTCCTAAAACCACGCTACCGAAAGTGTTGATCCACAAACCAGTGCCAGTGCTTGAACTTTGTTACTGGTCCACAGTTAGGTCCCCTCAGTGATTCCTGTGTGCACCCAGGGTTGAGAACTACTGCATAAGAGGTCCTAGAAGATATCTGGTATGGCCAGAGTACAGAGGGACCGGAGAAGAACTTCTGCTTGGGTGGCTGAACTCTGATCTTGACCTAGAGTCATGGCCATGGCAACCAAAGGAGGTACTGTCAAAGCTGCTTCAGGATTCAATGCCATGGAAGATGCCCAGACCCTGAGGAAGGCCATGAAAGGGCTCGGCACCGATGAAGACGCCATTATTAGCGTCCTTGCCTACCGCAACACCGCCCAGCGCCAGGAGATCAGGACAGCCTACAAGAGCACCATCGGCAGGGACTTGATAGACGACCTGAAGTCAGAACTGAGTGGCAACTTCGAGCAGGTGATTGTGGGGATGATGACGCCCACGGTGCTGTATGACGTGCAAGAGCTGCGAAGGGCCATGAAGGGAGCCGGCACTGATGAGGGCTGCCTAATTGAGATCCTGGCCTCCCGGACCCCTGAGGAGATCCGGCGCATAAGCCAAACCTACCAGCAGCAATATGGACGGAGCCTTGAAGATGACATTCGCTCTGACACATCGTTCATGTTCCAGCGAGTGCTGGTGTCTCTGTCAGCTGGTGGGAGGGATGAAGGAAATTATCTGGACGATGCTCTCGTGAGACAGGATGCCCAGGACCTGTATGAGGCTGGAGAGAAGAAATGGGGGACAGATGAGGTGAAATTTCTAACTGTTCTCTGTTCCCGGAACCGAAATCACCTGTTGCATGTGTTTGATGAATACAAAAGGATATCACAGAAGGATATTGAACAGAGTATTAAATCTGAAACATCTGGTAGCTTTGAAGATGCTCTGCTGGCTATAGTAAAGTGCATGAGGAACAAATCTGCATATTTTGCTGAAAAGCTCTATAAATCGATGAAGGGCTTGGGCACCGATGATAACACCCTCATCAGAGTGATGGTTTCTCGAGCAGAAATTGACATGTTGGATATCCGGGCACACTTCAAGAGACTCTATGGAAAGTCTCTGTACTCGTTCATCAAGGGTGACACATCTGGAGACTACAGGAAAGTACTGCTTGTTCTCTGTGGAGGAGATGATTAAAATAAAAATCCCAGAAGGACAGGAGGATTCTCAACACTTTGAATTTTTTTAACTTCATTTTTCTACACTGCTATTATCATTATCTCAGAATGCTTATTTCCAATTAAAACGCCTACAGCTGCCTCCTAGAATATAGACTGTCTGTATTATTATTCACCTATAATTAGTCATTATGATGCTTTAAAGCTGTACTTGCATTTCAAAGCTTATAAGATATAAATGGAGATTTTAAAGTAGAAATAAATATGTATTCCATGTTTTTAAAAGATTACTTTCTACTTTGTGTTTCACAGACATTGAATATATTAAATTATTCCATATTTTCTTTTCAGTGAAAAATTTTTTAAATGGAAGACTGTTCTAAAATCACTTTTTTCCCTAATCCAATTTTTAGAGTGGCTAGTAGTTTCTTCATTTGAAATTGTAAGCATCCGGTCAGTAAGAATGCCCATCCAGTTTTCTATATTTCATAGTCAAAGCCTTGAAAGCATCTACAAATCTCTTTTTTTAGGTTTTGTCCATAGCATCAGTTGATCCTTACTAAGTTTTTCATGGGAGACTTCCTTCATCACATCTTATGTTGAAATCACTTTCTGTAGTCAAAGTATACCAAAACCAATTTATCTGAACTAAATTCTAAAGTATGGTTATACAAACCATATACATCTGGTTACCAAACATAAATGCTGAACATTCCATATTATTATAGTTAATGTCTTAATCCAGCTTGCAAGTGAATGGAAAAAAAAATAAGCTTCAAACTAGGTATTCTGGGAATGATGTAATGCTCTGAATTTAGTATGATATAAAGAAAACTTTTTTGTGCTAAAAATACTTTTTAAAATCAATTTTGTTGATTGTAGTAATTTCTATTTGCACTGTGCCTTTCAACTCCAGAAACATTCTGAAGATGTACTTGGATTTAATTAAAAAGTTCACTTTGTAAGAACGTGGAAAAATAATTTTAATTTAAAAATGGTGTTTTTAGGCCGGGGGCGGGG