Transcript asmbl_77097

Sequence
Transcript Sequence for observation asmbl_77097 of TGE0056598:
GGAGGCCAGGGCCCGCCCCACAGCCACTCTCGCGCCTCCGAACAGCCACAGGGGCAAAGCCCTGTCACCCCCAGGATCCGGTCATCAGGGAAAGAGGACAGGGAGACCAGAAGAGGGCCAGCTGGGACGAGGGGGCGGACGCCCAGGAGGCAACTTCTGAGACGCAGCTCCTGAGAGGGGCAGGGACCAGGCGCGGGAGGCCAGAGGGGGCACAGAGAACAAACCCCCTCAGAAGTGAAGAGGAGAGCGGAAGGAACCGAGAGGGGACGGACAGGAGCTGAGGAGGAAAGAGGAGGGGAGAGGGGTCAGGCCAGGCAGCCAAGGAGAAGACGTGTGGCCGGGGGCTATCAGAAGGAAACTGGGACGGACGGGCCGGGCTCGGGCTGTCCTGTGGAGCAGCAGCATCCCCGGGGCCGGCAGAGGCGCCAGTGGCTGGGCGGGATGAGTCTCTGAGGGCCACTGTGGAGCGCCCCGCCATGGCCCCCCGCACCCTCTGGAGCTGCTACCTCTGCTGCCTGCTGACGGCAGCTGCAGGGGCCGCCAGCTACCCTCCTCGAGGTTTCAGCCTCTACACAGGTTCCAGTGGGGCCCTCAGCCCCGGGGGGCCCCAGGCCCAGATTGCCCCCCGGCCAGCCAGCCGCCACAGGAACTGGTGTGCCTACGTGGTGACCCGGACAGTGAGCTGTGTCCTTGAGGATGGAGTGGAGACATATGTCAAGTACCAGCCTTGTGCCTGGGGCCAGCCCCAGTGTCCCCAAAGCATCATGTACCGCCGCTTCCTCCGCCCTCGCTACCGTGTGGCCTACAAGACAGTGACCGACATGGAGTGGAGGTGCTGTCAGGGTTATGGGGGCGATGACTGTGCTGAGAGTCCCGCTCCAGCGCTGGGGCCTGCGTCTTCCACACCACGGCCCCTGGCCCGGCCTGCCCGCCCCAACCTCTCTGGCTCCAGTGCAGGCAGCCCCCTCAGTGGACTGGGGGGAGAAGGTCCTGGGGAGTCAGAGAAGGTGCAGCAGCTGGAGGAACAGGTGCAGAGCCTGACCAAGGAGCTGCAAGGCCTGCGGGGCGTCCTGCAAGGACTGAGCGGGCGCCTGGCAGAGGATGTGCAGAGGGCTGTGGAGACGGCCTTCAACGGGAGGCAGCAGCCAGCTGACGCGGCTGCCCGCCCTGGGGTGCATGAAACCCTCAATGAGATCCAGCACCAGCTGCAGCTCCTGGACACCCGCGTCTCCACCCACGACCAGGAGCTGGGTCACCTCAACAACCATCATGGCGGCAGCAGCAGCAGTGGGGGCAGCAGGGCCCCAGCCCCAGCCTCAGCCCCTCCGGGCCCCAGTGAGGAGCTGCTGCGGCAGCTGGAGCAGCGGTTGCAGGAGTCCTGCTCCGTGTGCCTGGCCGGGCTAGATGGCTTCCGCCGGCAGCAGCAGGAGGACAGGGAGCGGCTGCGAGCGATGGAGAAGCTGCTGGCCTCGGTGGAGGAGCGGCAACGGCACCTCGCAGGGCTGGCGGTGGGCCGCAGGCCCCCTCAGGAATGCTGCTCTCCAGAGCTGGGCCGGCGACTGGCAGAGCTGGAGCGCAGGCTGGATGTCGTGGCCGGCTCAGTGACAGTGCTGAGTGGGCGGCGAGGCACAGAGCTGGGAGGAGCCGCGGGGCAGGGAGGCCACCCCCCAGGCTACACCAGCTTGGCCTCCCGCCTGTCTCGCCTGGAGGACCGCTTCAACTCCACCCTGGGCCCTTCGGAGGAGCAGGAGGAGAGCTGGCCTGGGGCTCCTGGGGGGCTGAGCCACTGGCTGCCTGCTGCCCGGGGCCGACTAGAGCAGTTGGGGGGGCTGCTGGCCAATGTGAGCGGGGAGCTGGGGGGGCGGTTGGATCTGTTGGAGGAGCAGGTGGCAGGGGCCATGCAGGCATGCGGGCAGCTCTGCTCTGGGGCCCCTGGGGAGCAGGACTCTCAAGTCAGCGAGATCCTCAGTGCCTTGGAGCGCAGGGTGCTGGACAGTGAGGGGCAGCTGCGGCTGGTGGGCTCCGGCCTGCACACGGTGGAAGCAGCGGGGGAGGCCCGGCAGGCCACGCTGGAGGGATTACAAGAGGTTGTGGGCCGGCTCCAGGATCGTGTGGATGCCCAGGATGAGACAGCTGCAGAGTTCACACTACGGCTGAATCTCACTGCGGCCCGGCTAGGCCAACTGGAGGGGCTGCTGCAGGCCCATGGGGATGAGGGCTGTGGGGCCTGTGGCGGAGTCCAAGAGGAACTAGGCCGCCTTCGGGATGGTGTGGAGCGCTGCTCCTGCCCCCTGTTGCCTCCTCGGGGTCCTGGGGCTGGTCCAGGTGTTGGGGGCCCAAGCCGTGGGCCCCTGGACGGCTTCAGCGTGTTTGGGGGCAGCTCAGGCTCAGCCCTGCAGGCCCTGCAAGGAGAGCTCTCTGAGGTTATTCTCAGCTTCAGCTCCCTCAATGACTCACTGAATGAGCTCCAGACCACTGTGGAGGGCCAGGGCGCTGATCTGGCTGACCTGGGGGCAACCAAGGACCGTATCATTTCTGAGATTAACAGGCTGCAGCAGGAGGCCACAGAGCATGCTACAGAGAGTGAAGAGCGCTTCCGAGGCCTAGAGGAGGGACAAGCACAGGCCGGCCAGTGCCCCAGCTTAGAGGGGCGATTGGGCCGTCTTGAGGGTGTCTGTGAACGGTTGGACACTGTGGCTGGGGGACTGCAGGGCCTGCGCGAGGGCCTTTCCAGACACGTGGCTGGGCTCTGGGCTGGGCTCCGGGAAACCAACACCACCAGCCAGATGCAGGCAGCCCTGCTGGAGAAGCTGGTCGGGGGACAGGCGGGCCTGGGCAGGCGGCTGGGTGCCCTTAACAGCTCCCTGCAGCTCCTGGAGGACCGTCTGCACCAGCTCAGCCTGAAGGACCTCACTGGGCCTGCAGGAGAGGCTGGGCCCCCAGGGCCTCCTGGGCTGCAGGGACCCCCAGGCCCTGCTGGACCTCCAGGATCACCAGGCAAGGACGGGCAAGAGGGCCCCATCGGGCCACCAGGTCCTCAAGGTGAACAGGGAGTGGAGGGGGCACCAGCAGCCCCTGTGCCCCAAGTGGCATTTTCAGCTGCTCTGAGTTTGCCCCGGTCTGAACCAGGCACGGTCCCCTTCGACAGAGTCCTGCTCAATGATGGAGGCTATTATGATCCAGAGACAGGCGTGTTCACAGCGCCACTGGCTGGACGCTACTTGCTGAGCGCGGTGCTGACTGGGCACCGGCACGAGAAAGTGGAGGCCGTGCTGTCCCGCTCCAACCAGGGCGTGGCCCGCGTAGACTCCGGTGGCTACGAGCCTGAGGGCCTGGAGAATAAGCCGGTGGCCGAGAGCCAGCCCAGCCCGGGCACCCTGGGCGTCTTCAGCCTCATCCTGCCGCTGCAGGCCGGGGACACGGTCTGCGTCGACCTGGTCATGGGGCAGCTGGCGCACTCGGAGGAGCCGCTCACCATCTTCAGCGGGGCCCTGCTCTATGGGGACCCAGAGCTTGAACACGCGTAGACTGGGGTCCCGCCCGACGTGTCTACGTCGGCTGAAGAGACAGCGGGGGCGGCGGGCTCCTGGGGTCTCGCCTGAGACGGGGCACCTAGCCCTGGGCGAGCGCCGCACCCGGGCCCGCAGCGGCACCGCGCCCAGAGCGGCCTCTCCCCACGCCCGGGGCGCGCCGGCTCAGGGAGGCTCGGGGCCGCCCATGCAGACTTTTGGCCTGGCGCGATCCCCCAAGAACCCCTCCAGGGCCGGCCTGCGGAGGAGCCGATCCTCGCACCCTCCGCTCCCTCCACTGGCCCTCCAGGTCGATTCCCTGGGCTCCAGGCTCCCCCGCGCGGGCGCCGCCCACCGCCATACTAAACGATCGAGGAATAAAGACACTTGGT