Transcript asmbl_77074

Sequence
Transcript Sequence for observation asmbl_77074 of TGE0001226:
GACCGCCCGCGGGGTGAGGGGCCCTTTCTGGGCAGGACCCGCCCCTTGGTCCCGCAGAGCCTTGGTACTTGGACCTGAACCTTGCTCCGAGAGGGAGTCCTCGCGGACGTCAGCCAAGATTCCAGAATGACTATCTTGACTTACCCCTTTAAAAATCTTCCCACTGCATCAAAATGGGCCCTCAGATTTTCCATAAGACCTCTGAGCTGTTCCTCCCAGCTACGAGCTGCCCCAGCTGTCCAGACCAAAACGAAGAAGACGTTAGCCAAACCCAATATAAGGAATGTTGTGGTGGTGGATGGTGTTCGCACTCCATTTTTGCTGTCTGGCACTTCATATAAAGACCTGATGCCACATGATTTGGCTAGAGCAGCGCTTACGGGTTTGTTGCATCGGACCAGTGTCCCTAAGGAAGTAGTTGATTATATCATCTTTGGTACAGTTATTCAGGAAGTGAAAACAAGCAATGTGGCTAGAGAGGCTGCCCTTGGAGCTGGCTTCTCTGACAAGACTCCTGCTCACACTGTCACCATGGCTTGTATCTCTGCCAACCAAGCCATGACCACAGGTGTTGGCTTGATTGCTTCTGGCCAGTGTGATGTGATCGTGGCAGGTGGTGTTGAGTTGATGTCCGATGTCCCTATTCGTCACTCAAGGAAAATGAGAAAACTGATGCTTGATCTCAATAAGGCCAAATCTATGGGCCAGCGACTGTCTTTAATCTCTAAATTCCGATTTAATTTCCTAGCACCTGAGCTCCCTGCGGTTTCTGAGTTCTCCACCAGTGAGACCATGGGCCACTCTGCAGACCGACTGGCCGCTGCCTTTGCTGTTTCTCGGCTGGAACAGGATGAATATGCACTGCGCTCTCACAGTCTAGCCAAGAAGGCACAGGATGAAGGACTCCTTTCTGATGTGGTACCCTTCAAAGTACCAGGAAAAGATACAGTTACCAAAGATAATGGCATCCGTCCTTCCTCACTGGAGCAGATGGCCAAACTAAAACCTGCATTCATCAAGCCCTACGGCACAGTGACAGCTGCAAATTCTTCTTTCTTGACTGATGGTGCATCTGCAATGTTAATCATGGCGGAGGAAAAGGCTCTGGCCATGGGTTATAAGCCGAAGGCATATTTGAGGGATTTTATGTATGTGTCTCAGGATCCAAAAGATCAACTATTACTTGGACCAACATATGCTACTCCAAAAGTTCTAGAAAAGGCAGGATTGACCATGAATGATATTGATGCTTTTGAATTTCATGAAGCTTTCTCGGGTCAGATTTTGGCAAATTTTAAAGCCATGGATTCTGATTGGTTTGCAGAAAACTACATGGGTAGAAAAACCAAGGTTGGATTGCCTCCTTTGGAGAAGTTTAATAACTGGGGTGGATCTCTGTCCCTGGGACACCCATTTGGAGCCACTGGCTGCAGGTTGGTCATGGCTGCTGCCAACAGATTACGGAAAGAAGGAGGCCAGTATGGCTTAGTGGCTGCGTGTGCAGCTGGAGGGCAGGGCCATGCTATGATAGTGGAAGCTTATCCAAAATAATAGATCCAGAAGAAGTGACCTGAAGTTTCTGTGCAACACTCACACTAGGCAATGCCATTTCAATGCATTACTAAATGACATTTGTAGTTCCTAGCTCCTCTTAGGAAAACAGTTCTTGTGGCCTTCTATTAAATAGTTTGCACTTAAGCCTTGCCAGTGTTCTGAGCTTTTCAATAATCAGTTTACTGCTCTTTCAGGGATTTCTAAGCCACCAGAATCTCACATGAGATGTGTGGGTGGTTGTTTTTGGTCTCTGTTGTCACTAAAGACTAAATGAGGGTTTGCAGTTGGGAAAGAGGTCAACTGAGATTTGGAAATCATCTTTGTAATATTTGCAAATTATACTTGTTCTTATCTGTGTCCTAAAGATGTGTTCTCTATAAAATACAAACCAACGTGCCTAATTAATTATGGAAAAATAATTCAGAATCTAAACACCACTGAAAACTTATAAAAAATGTTTAGATACATAAATATGGTGGTCAGCGTTAATAAAGTGGAGAAATATTGGAGA