Transcript asmbl_70690

Sequence
Transcript Sequence for observation asmbl_70690 of TGE0059669:
GTGGAGGGCATCGTGGGGCTGGAACAGGTGAGCAGCCTGGGCGACGGCCCACCAGGTGGCCGCCCCCGTCGGGGTATGTTCCGGACAGTGGGACAGCTCTACAAGGAGTCCCTGAGCCGCCTCATGGCCACACTCAGCAACACCAACCCCAGTTTTGTCCGCTGCATTGTCCCCAACCACGAGAAGAGGGCCGGGAAGCTGGAGCCACGGCTGGTGCTGGACCAGCTTCGCTGCAACGGGGTCCTGGAGGGCATCCGCATCTGTCGCCAGGGCTTCCCCAACCGCATCCTCTTCCAGGAGTTCCGGCAGCGATACGAGATCCTGACACCCAATGCCATCCCCAAGGGCTTCATGGATGGGAAGCAGGCCTGTGAAAAGATGATCCAGGCGCTGGAACTGGACCCCAACCTCTACCGCGTGGGACAGAGCAAGATCTTCTTCCGGGCTGGGGTCCTGGCCCAGCTGGAAGAGGAGCGAGACCTGAAGGTCACCGACATCATCGTCTCCTTCCAGGCAGCTGCCCGGGGATACCTGGCTCGCAGGGCCTTCCAGAAGCGCCAGCAGCAGCAGAGCGCCCTGAGGGTGATGCAGCGGAACTGCGCGGCCTACCTCAAGCTGAGACACTGGCAGTGGTGGCGGCTGTTTACCAAGGTGAAGCCACTGCTGCAGGTGACGCGGCAGGATGAGGTGCTGCAGGCACGGGCCCAGGAGCTGCAGAAAGTGCAGGAGCTACAGCAGCAGAGCGCCCGCGAAGTTGGGGAGCTCCAGGGCCGAGTGGCACAGCTGGAAGAGGAGCGCGCCCGCCTGGCAGAGCAATTGCGAGCAGAGGCAGAACTGTGTGCAGAGGCCGAGGAGACGCGGGGGAGGCTGGCAGCCCGCAAGCAGGAGCTGGAGCTGGTGGTGTCAGAGCTGGAGGCTCGCGTGGGCGAGGAGGAGGAGTGCAGCCGTCAAATGCAAACCGAGAAGAAGAGGCTGCAGCAGCACATACAGGAGCTAGAGGCCCACCTTGAGGCTGAGGAGGGTGCGCGGCAGAAGCTGCAGCTGGAGAAGGTGACGACAGAGGCAAAAATGAAGAAATTTGAAGAGGACCTGCTGCTCCTGGAAGACCAGAATTCCAAGCTGAGCAAGGAGCGGAAGCTGCTGGAAGATCGTCTGGCCGAGTTCTCATCCCAGGCAGCTGAGGAGGAGGAGAAGGTCAAGAGCCTCAATAAGCTACGGCTCAAATATGAGGCCACAATCGCAGACATGGAGGACCGCCTACGGAAGGAGGAGAAGGGTCGCCAGGAGCTGGAGAAGCTGAAGCGGAGGCTGGATGGGGAGAGCTCAGAGCTGCAGGAGCAGATGGTGGAGCAGCAACAGCGGGCAGAGGAGCTGCGGGCCCAGCTGGGCCGGAAGGAGGAGGAGCTGCAGGCTGCCCTGGCCAGGGCAGAAGACGAGGGTGGGGCCCGGGCCCAGCTGCTGAAATCCCTGCGGGAGGCTCAAGCAGCCCTGGCCGAGGCCCAGGAGGACCTGGAGTCTGAGCGTGTGGCCAGGACCAAGGCGGAGAAGCAGCGCCGGGACCTGGGCGAGGAGCTGGAGGCGCTGCGGGGCGAGCTGGAGGACACGCTGGACTCCACCAACGCACAGCAGGAGCTCCGGTCCAAGAGGGAACAGGAGGTGACGGAGCTGAAGAAGACTCTGGAGGAGGAGACTCGCATCCACGAGGCGGCAGTGCAGGAGCTGAGGCAGCGCCACGGCCAGGCCCTGGGGGAGCTGGCGGAGCAGCTGGAG