Transcript asmbl_70565

Sequence
Transcript Sequence for observation asmbl_70565 of TGE0057808:
CACCCGGCTCAGACGGCTCCGGACGGGACCGCGAGCACAGGCCGCTCCGCGGGCGCTTCGGATCCTCGCGGGACCCCACCCTCTCCCAGCCTGCCCAGCCCGCTGCAGCCGCCAGCGCGCCCCGTCGGCAGCTCTCCATCTGCACGTCTCTCCGTGAACCCCGTGAGCGGTGTGCAGCCACCATGTTCAGCTGGCTGAAGCGGGGCGGGGCACGGGGCCAGCAGCCCGAGGCCATCCGCACGGTGACCTCGGCCCTCAAGGAGCTGTACCGCACGAAGCTGCTGCCGCTGGAGGAGCACTACCGCTTTGGGGCCTTCCACTCGCCGGCCCTGGAGGACGCAGACTTCGACGGCAAGCCCATGGTGCTGGTGGCCGGCCAGTACAGCACGGGCAAGACCAGCTTCATCCAGTACCTGCTGGAGCAGGAGGTGCCCGGCTCCCGCGTGGGGCCTGAGCCCACCACCGACTGCTTTGTGGCCGTCATGCACGGGGACACTGAGGGCACCGTGCCCGGCAACGCCCTCGTCGTGGACCCGGACAAGCCCTTCCGCAAACTCAACCCTTTCGGAAACACCTTCCTCAACAGGTTCATGTGTGCCCAGCTCCCTAATCAGGTCCTGGAGAGCATCAGCATCATCGACACCCCGGGTATCCTGTCGGGTGCCAAGCAGAGAGTGAGCCGCGGCTACGACTTCCCGGCCGTGCTGCGCTGGTTCGCGGAGCGCGTGGACCTCATCATCCTGCTCTTTGATGCGCACAAGCTGGAGATCTCGGACGAGTTCTCAGAGGCCATCGGCGCGTTGCGGGGCCATGAGGACAAGATCCGCGTGGTGCTCAACAAGGCCGACATGGTGGAGACGCAGCAGCTGATGCGCGTCTACGGCGCGCTCATGTGGGCGCTGGGCAAGGTGGTGGGCACGCCCGAGGTGCTGCGCGTCTACATCGGCTCCTTCTGGTCCCAGCCCCTCCTCGTGCCCGACAACCGGCGCCTCTTCGAGCTGGAGGAGCAGGACCTCTTCCGCGACATCCAGGGCCTGCCCCGGCACGCAGCCTTGCGCAAGCTCAACGACCTGGTGAAGAGGGCCCGGCTGGTGCGAGTTCACGCTTACATCATCAGCTACCTGAAGAAGGAGATGCCCTCTGTGTTTGGGAAGGAGAACAAGAAGAAGCAGCTGATCCTCAAACTGCCCGTCATCTTTGCGAAGATTCAGCTGGAACATCACATCTCCCCTGGGGACTTTCCTGATTGCCAGAAAATGCAGGAGCTGCTGATGGCGCACGACTTCACCAAGTTTCACTCGCTGAAGCCGAAGCTGCTAGAGGCACTGGACGAGATGCTGACGCACGACATCGCCAAGCTCATGCCCCTGCTGCGGCAGGAGGAGCTGGAGAGCACCGAGGTGGGCGTGCAGGGGGGCGCTTTTGAGGGCACCCACATGGGCCCGTTTGTGGAGCGGGGACCTGACGAGGCCATGGAGGACGGCGAGGAGGGCTCGGACGACGAGGCCGAGTGGGTGGTGACCAAGGACAAGTCCAAATACGACGAGATCTTCTACAACCTGGCGCCTGCCGACGGCAAGCTGAGCGGCTCCAAGGCCAAGACCTGGATGGTGGGGACCAAGCTCCCCAACTCAGTGCTGGGGCGCATCTGGAAGCTCAGCGATGTGGACCGCGACGGCATGCTGGATGATGAGGAGTTCGCGCTGGCCAGCCACCTCATCGAGGCCAAGCTGGAAGGCCACGGGCTGCCCGCCAACCTGCCCCGTCGCCTGGTGCCACCCTCCAAGCGACGCCACAAGGGCTCCGCCGAGTGAGCCGGCCCCCCTCCCATGGCCCTGCTGTGGCTCCCCAGCTCCAGTCGGCTGCACGCACACCCCTGCTCCGGCTCACACACGCCCTGCCTGCCCTCCCTGCCCAGCTGTAAGGACCGGGGGTCTCCCTCCTCACTACCGCCAGACACCCCGGTGGAAGCATTTAGAGGGGACCACGGGAGGGACAAGGCTTCTCTGTCCGCCCTTCACACCTCCAGCCTCACGTTCACTTAGGCACATCACACACACACTGGCACACGCAGGCATCCATCCATCCGTCATTCATTCAAATATTTATTGAGCACCTACTATGTGCCCAGCCCTGTTCTAGGCACTGGGCATTACCATAGAGAACAAAATAGACAAATACATCTGCCCTCATGGAAGGTGACGTTCCCAGGAGAGGGCACCTACACAGTCACGCAAACACACACTAATTCCTGGCAGGGCCCCCAGCCCCTCCCCTGGCTGAGCAGCCCTGTGGCTGAAATGACTAGCAGATAAACAGACCCCCTTCTGCTCCGCTTCCTCCTGCCCAGCCAGGCAACACCCTCAACCGGCTCCATCACATCCTCAGGTCTCGGGACCATGGGGGGCTCAGAGGGGAGACACACCTACTGCTTCCTCAGATGGGCCCCTCCGCAGCCCCTTCCCTTGCTCGGGGAAAGCCCCCAATTCTGCCCACACCCATTTATTTCCTTCCTTCCTTCCTTCTTTTCTTTCCTTCCTTCCTTCTTTT