Transcript asmbl_70535

Sequence
Transcript Sequence for observation asmbl_70535 of TGE0057064:
AGGGAGTGGATGCCTGCATTTCCTCTTCAGGCCGGCCAGAGGCATTCTGCAGCCTCCCCTCCTCGTCCCAGCCAGCCAACCCTGGCTAACACACTCAGACAAAGAATCCTTTCGGCTCTCATTCACTCCATGACTTTGGTTCATTTCATCATTTCAAGGGAGAAGTCAAAGCCAGGGACCAAACAGAAATGTAGAATCATCTAAGGACAGCTGTCAGACCATTTTCCCCACTGTCTTCACTGGCTGGCCAGAAAAATAGCTTCACCTAGCACAGTGTTGATGTTCAATAACTGTTGAATGAAGGTTGGAAGGGCTTTGCCCTGAGCACTGAGGAGAGAGAGCTGGTTGCGTGGGACTTGAAGTCTGTCTCAGTTTCTTTAGGTGGGACTGATGCCCTTGGCCTTCCTCCAGGGAAGGCATCCAGCATCCAGAGGTAAGGATTCTCCTGTGGACCTTGTGACCTCTGACTCCTCCCCCTTCTTCCCCCAGAGTTCAAGGAGGCCTTCTCCCTCTTTGACAAGGATGGAGATGGCACTATCACCACCAAGGAGTTGGGGACAGTGATGAGATCCCTGGGACAGAACCCCACTGAAGCAGAGCTGCAGGATATGATCAATGAGGTGGATGCAGATGGGAACGGGACCATTGACTTCCCGGAGTTCCTGACCATGATGGCCAGAAAGATGAAGGACACAGACAGTGAGGAGGAGATCCGAGAGGCGTTCCGTGTCTTTGACAAGGATGGGAATGGCTACATCAGCGCCGCAGAGCTGCGTCACGTAATGACGAACCTGGGGGAGAAGCTGACCGATGAGGAGGTGGATGAGATGATCAGGGAGGCTGACATCGATGGAGATGGCCAGGTCAATTATGAAGAGTTTGTACAGATGATGACTGCAAAGTGAAGGCCCCCCGGGCAGCTGGCGATGCCCGTTCTCTTGATCTCTCTCTTCTCGCGCGCGCACTCTCTCTTCAACACTCCCCTGCGTACCCCGGTTCTAGCAAACACCAATTGATTGACTGAGAATCTGATAAAGCAACAAAAGATTTGTCCCAAGCTGCATGATTGCTCTTTCTCCTTCTTCCCTGAGTCTCTCTCCATGCCCCTCATCTCTTCCTTTTGCCCTCGCCTCTTCCATCCATGTCTTCCAAGGCCTGATGCATTCATAAGTTGAAGCCCTCCCCAGATCCCCTTGGGGAGCCTCTGCCCTCCTCCAGCCCGGATGGCTCTCCTCCATTTTGGTTTGTTTCCTCTTGTTTGTCATCTTATTTTGGGTGCTGGGGTGGCTGCCAGCCCTGTCCCGGGACCTGCTGGGAGGGACAAGAGGCCCTCCCCCAGGCAGAAGAGCATGCCCTTTGCCGTTGCATGCAACCAGCCCTGTGATTCCACGTGCAGATCCCAGCAGCCTGTTGGGGCAGGGGTGCCAAGAGAGGCATTCCAGAAGGACTGAGGGGGCGTTGAGGAATTGTGGCGTTGACTGGATGTGGCCCAGGAGGGGGTCGAGGGGGCCAACTCACAGAAGGGGACTGACAGTGGGCAACACTCACATCCCACTGGCTGCTGTTCTGAAACCATCTGATTGGCTTTCTGAGGTTTGGCTGGGTGGGGACTGCTCATTTGGCCACTCTGCAAATTGGACTTGCCCGCGTTCCTGAAGCGCTCTCGAGCTGTTCTGTAAATACCTGGTGCTAACATCCCATGCCGCTCCCTCCTCACGATGCACCCACCGCCCTGAGGGCCCGTCCTAGGAATGGATGTGGGGATGGTCGCTTTGTAATGTGCTGGTTCTCTTTTTTTTTCTTTCCCCTCTATGGCCCTTAAGACTTTCATTTTGTTCAGAACCATGCTGGGCTAGCTAAAGGGTGGGGAGAGGGAAGATGGGCCCCACCACGCTCTCAAGAGAACGCACCTGCAATAAAACAGTCTTGTCGGCCAGCTGCCCAGGGGACGGCAGCTACAGCAGCCTCTGCGTCCTGGTCCGCCAGCACCTCCCGCTTCTCCGTGGTGACTTGGCGCCGCTTCCTCACATCTGTGCTCCGTGCCCTCTTCCCTGCCTCTTCCCTCGCCCACCTGCCTGCCCCCATACTCCCCCAGCGGAGAGCATGATCCGTGCCCTTGCTTCTGACTTTCGCCTCTGGGACAAGTAAGTCAATGTGGGCAGTTCAGTCGTCTGGGTTTTTTCCCCTTTTCTGTTCATTTCATCTGGCTCCCCCCACCACCTCCCCACCCCACCCCCCACCCCCTGCTTCCCCTCACTGCCCAGGTCGATCAAGTGGCTTTTCCTGGGACCTGCCCAGCTTTGAGAATCTCTTCTCATCCACCCTCTGGCACCCAGCCTCTGAGGGAAGGAGGGATGGGGCATAGTGGGAGACCCAGCCAAGAGCTGAGGGTAAGGGCAGGTAGGCGTGAGGCTGTGGACATTTTCGGAATGTTTTGGTTTTGTTTTTTTTAAACCGGGCAATATTGTGTTCAGTTCAAGCTGTGAAGAAAAATATATATCAATGTTTTCCAATAAAATACAGTGACTACCTG