Transcript asmbl_70401

Sequence
Transcript Sequence for observation asmbl_70401 of TGE0010732:
TTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGGTAAGCGGGGGCTCCGAGCTGGACCGGGCGCGAGGCGGCAGGGCCGGACGCCGAAGCCTCAGAGCGCGTGCCTGAGGGCCCCGAGGCGCCCGGCGCGGGCCCGTCCCGCCCCCTAGAGCCGCGGCCACGTGCGAGCGGCAGGCCCGGACATGCCCGATGCCTGGAGTTACTGTAAAAGACGTGAACCAGCAGGAGTTCGTCAGAGCTCTGGCAGCCTTCCTCAAAAAGTCCGGGAAGCTGAAAGTCCCCGAATGGGTGGATACCGTCAAGCTGGCCAAGCACAAAGAGCTTGCTCCCTACGATGAGAACTGGTTCTACACGCGAGCTGCTTCCACAGCGCGGCACCTGTACCTCCGGGGTGGCGCTGGGGTTGGCTCCATGACCAAGATCTATGGGGGACGTCAGAGAAACGGCGTCATGCCCAGCCACTTCAGCCGAGGCTCCAAGAGTGTGGCCCGCCGGGTCCTCCAAGCCCTGGAGGGGCTGAAAATGGTGGAAAAGGACCAAGATGGCGGCCGCAAACTGACACCTCAGGGACAAAGAGATCTGGACAGAATCGCCGGACAGGTGGCAGCTGCCAACAAGAAGCATTAGAACAAACCATGCTGGGTTAATAAATTGCCTCATTCGTAATCCTGGTCTGGGTCTCTTTTTTGAGTCTCTTGCTCTGTCGCCCAGGCTGG