Transcript asmbl_70295

Sequence
Transcript Sequence for observation asmbl_70295 of TGE0001148:
GCTGAAGCAGCTGAAGCGGCGGTAGCGGCGGCGGCTCGGGCAGAGGGGCGGGAGCTGAGGCGGGAGCGGACAGGCTGGTGGGCGAGCGAGAGGCGGCGGAATGGTGGACTACCACGCGGCGAACCAGTCGTACCAGTACGGCCCCAGCAGCGCGGGCAATGGCGCTGGCGGCGGGGGCAGCATGGGCGACTACATGGCCCAGGAGGACGACTGGGACCGGGACCTGCTGCTGGACCCGGCCTGGGAGAAGCAGCAGCGCAAGACCTTCACGGCATGGTGCAACTCCCACCTGCGGAAGGCAGGCACACAGATCGAGAACATTGATGAGGACTTCCGAGACGGGCTCAAGCTCATGCTGCTCCTGGAGGTCATATCAGGGGAGCGGTTACCTAAGCCGGAGCGGGGGAAGATGAGAGTGCACAAAATCAACAATGTGAACAAAGCGCTGGACTTTATTGCCAGCAAAGGCGTCAAGCTGGTCTCCATCGGGGCAGAAGAGATTGTGGACGGCAACGCAAAGATGACCCTGGGAATGATCTGGACCATCATCCTTAGGTTCGCCATCCAGGACATCTCCGTGGAAGAGACCTCGGCCAAGGAAGGGCTCCTTCTCTGGTGCCAGAGAAAGACAGCCCCGTATAAGAACGTCAATGTGCAGAACTTCCACATCAGCTGGAAGGATGGTCTTGCCTTCAATGCCCTGATCCACCGGCACAGACCAGAGCTGATTGAGTATGACAAGCTGAGGAAGGACGACCCTGTCACCAACCTGAACAATGCCTTCGAAGTGGCTGAGAAATACCTCGACATCCCCAAGATGCTGGATGCAGAGGACATCGTGAACACGGCCCGGCCCGACGAGAAGGCCATAATGACCTATGTGTCCAGCTTCTACCATGCCTTTTCAGGAGCGCAGAAGGCTGAAACTGCCGCCAACCGGATCTGTAAGGTGCTGGCTGTCAACCAAGAGAACGAGCACCTGATGGAGGACTACGAGAAGCTGGCCAGCGACCTCCTGGAGTGGATCCGGCGCACCATCCCCTGGCTGGAGGACCGTGTGCCCCAAAAGACTATCCAGGAGATGCAGCAGAAGCTGGAGGACTTCCGCGACTACCGGCGTGTGCACAAGCCGCCCAAGGTGCAGGAGAAGTGCCAGCTGGAGATCAACTTCAACACGCTGCAGACCAAGCTGCGCCTCAGCAACCGGCCCGCCTTCATGCCCTCCGAGGGCAAGATGGTCTCGGACATCAACAATGGCTGGCAGCACTTGGAGCAGGCTGAGAAGGGCTACGAGGAGTGGCTGCTGAATGAGATCCGCAGGCTGGAGCGGCTCGACCACCTGGCAGAGAAGTTCCGGCAGAAGGCCTCCATCCACGAGGCCTGGACTGACGGGAAGGAAGCCATGCTGAAGCACCGGGACTACGAGACGGCCACACTATCGGACATCAAAGCCCTCATTCGCAAGCACGAGGCCTTCGAGAGCGACCTGGCTGCGCACCAGGACCGCGTGGAGCAGATCGCCGCCATTGCCCAGGAGCTCAACGAGCTGGATTACTACGACTCCCACAATGTCAACACCCGGTGCCAGAAGATCTGTGACCAGTGGGACGCCCTCGGCTCTCTGACACATAGTCGCAGGGAAGCCCTGGAGAAAACAGAGAAGCAGCTGGAGGCCATCGACCAGCTGCACCTGGAATACGCCAAGCGCGCGGCCCCCTTCAACAACTGGATGGAGAGCGCCATGGAGGACCTCCAGGACATGTTCATCGTCCATACCATCGAGGAGATTGAGGGCCTGATCTCAGCCCATGACCAGTTCAAGTCCACCCTGCCGGACGCCGATAGGGAGCGCGAGGCCATCCTGGCCATCCACAAGGAGGCCCAGAGGATCGCTGAGAGCAACCACATCAAGCTGTCGGGCAGCAACCCCTACACCACCGTCACCCCGCAAATCATCAACTCCAAGTGGGAGAAGGTGCAGCAGCTGGTGCCAAAACGGGACCATGCCCTCCTGGAGGAGCAGAGCAAGCAGCAGTCCAACGAGCACCTGCGCCGCCAGTTCGCCAGCCAGGCCAATGTTGTGGGGCCCTGGATCCAGACCAAGATGGAGGAGATCGGGCGCATCTCCATTGAGATGAACGGGACCCTGGAGGACCAGCTGAGCCACCTGAAGCAGTATGAACGCAGCATCGTGGACTACAAGCCCAACCTGGACCTGCTGGAGCAGCAGCACCAGCTCATCCAGGAGGCCCTCATCTTCGACAACAAGCACACCAACTATACCATGGAGCACATCCGCGTGGGCTGGGAGCAGCTGCTCACCACCATTGCCCGCACCATCAACGAGGTGGAGAACCAGATCCTCACCCGCGACGCCAAGGGCATCAGCCAGGAGCAGATGCAGGAGTTCCGGGCGTCCTTCAACCACTTCGACAAGGATCATGGCGGGGCGCTGGGGCCCGAGGAGTTCAAGGCCTGCCTCATCAGCCTGGGCTACGACGTGGAGAACGACCGGCAGGGTGAGGCCGAGTTCAACCGCATCATGAGCCTGGTCGACCCCAACCATAGCGGCCTTGTGACCTTCCAAGCCTTCATCGACTTCATGTCGCGGGAGACCACCGACACGGACACGGCTGACCAGGTCATCGCTTCCTTCAAGGTCTTAGCAGGGGACAAGAACTTCATCACAGCTGAGGAGCTGCGGAGAGAGCTGCCCCCCGACCAGGCCGAGTACTGCATCGCCCGCATGGCGCCATACCAGGGCCCTGACGCCGTGCCCGGTGCCCTCGACTACAAGTCCTTCTCCACGGCCTTGTATGGCGAGAGCGACCTGTGAGGCCCCAGAGACCTGACCCAACACCCCCGACGGCCTCCAGGAGGGGCCTGGGCAGCCCCACAGTCCCATTCCTCCACTCTGTATCTATGCAAAGCACTCTCTGCAGTCCTCCGGGGTGG