Transcript asmbl_69481

Sequence
Transcript Sequence for observation asmbl_69481 of TGE0059666:
CCGCGGCCAAGGGGTTTCGGTGATCTCGGGAGAGAAGCGGCCGCCCCGAGGGTCTGTCCTCCGCCCCGGGGCCGGAGGGGCCTCTCCAGGGACCCCCGCGGGCGCCGTCATGGGGAGGGGCCTTCCCGGCTCTCGGGCCGGGGCAGCCTTTCCGGGCGGCTTTGCTGGGCGGGCTTCCCTTGGGAGAGGTGGGAGCCCCCTCCAGAAAGGCCGTGTCCCGCCGAGCGCTTCCTGCGCGAGGCCCTCCCTGGGAATAGGAAGCGGGAGAGGCTGGAGATGTTTCGCATTCTTTCCGTTTTCCTGAGAAGTTTTTCTTGGGTTCAGTCACTTTTAAAAGTCTGTTAAACGTGGTCCGTGCAGTCTGTGGTGTCAGAAGAGGCGCAGCCCTAGAGTGGGTCTGGACCCCTTAGCATGCGTGCGGGCAGCATTGTCCCAGATATAGCCGTTGGTACAAAGCGGGGATCTGACGAGCTTTTCTCTACTTGTGTCACTAACGGACCGTTTATCATGAGCAGCAACTCGGCTTCTGCAGCAAACGGAAATGACAGCAAGAAGTTCAAAGGTGACAGCCGAAGTGCAGGCGTCCCCTCTAGAGTGATCCACATCCGGAAGCTCCCCATCGACGTCACGGAGGGGGAAGTCATCTCCCTGGGGCTGCCCTTTGGGAAGGTCACCAACCTCCTGATGCTGAAGGGGAAAAACCAGGCCTTCATCGAGATGAACACGGAGGAGGCTGCCAACACCATGGTGAACTACTACACCTCGGTGACCCCTGTGCTGCGCGGCCAGCCCATCTACATCCAGTTCTCCAACCACAAGGAGCTGAAGACCGACAGCTCTCCCAACCAGGCGCGGGCCCAGGCGGCCCTGCAGGCGGTGAACTCGGTCCAGTCGGGGAACCTGGCCTTGGCTGCCTCGGCGGCGGCCGTGGACGCAGGGATGGCGATGGCCGGGCAGAGCCCCGTGCTCAGGATCATCGTGGAGAACCTCTTCTACCCTGTGACCCTGGATGTGCTGCACCAGATTTTCTCCAAGTTCGGCACAGTGTTGAAGATCATCACCTTCACCAAGAACAACCAGTTCCAGGCCCTGCTGCAGTATGCGGACCCCGTGAGCGCCCAGCACGCCAAGCTGTCGCTGGACGGGCAGAACATCTACAACGCCTGCTGCACGCTGCGCATCGACTTTTCCAAGCTCACCAGCCTCAACGTCAAGTACAACAATGACAAGAGCCGTGACTACACACGCCCAGACCTGCCTTCCGGGGACAGCCAGCCCTCGCTGGACCAGACCATGGCCGCGGCCTTCGGTGCACCTGGTATAATCTCAGCCTCTCCGTATGCAGGAGCTGGTTTCCCTCCCACCTTTGCCATTCCTCAAGCTGCAGGCCTTTCCGTTCCGAACGTCCACGGCGCCCTGGCCCCCCTGGCCATCCCCTCGGCGGCGGCGGCAGCTGCGGCGGCAGGTCGGATCGCCATCCCGGGCCTGGCGGGGGCAGGAAATTCTGTATTGCTGGTCAGCAACCTCAACCCAGAGAGAGTCACACCCCAAAGCCTCTTTATTCTTTTCGGCGTCTACGGTGACGTGCAGCGCGTGAAGATCCTGTTCAATAAGAAGGAGAACGCCCTAGTGCAGATGGCGGACGGCAACCAGGCCCAGCTGGCCATGAGCCACCTGAACGGGCACAAGCTGCACGGGAAGCCCATCCGCATCACGCTCTCGAAGCACCAGAACGTGCAGCTGCCCCGCGAGGGCCAGGAGGACCAGGGCCTGACCAAGGACTACGGCAACTCACCCCTGCACCGCTTCAAGAAGCCGGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTGATCCAGATGGGCTCCGTGGAGGAGGCGGTCCAGGCCCTCATTGACCTGCACAACCACGACCTCGGGGAGAACCACCACCTGCGGGTCTCCTTCTCCAAGTCCACCATCTAGGGGCACAGGCCCCCACGGCCGGGCCCCCTGGCGACAACTTCCATCATTCCAGAGAAAAGCCACTTTAAAAACAGCTGAAGTGACCTTAGCAGACCAGAGATTTTATTTTTTTAAAGAGAAATCAGTTTACCTGTTTTTAAAAAAATTAAATCTAGTTCACCTTGCTCACCCTGCGGTGACAGGGACAGCTCAGGCTCTTGGTGACTGTGGCAGCGGGAGTTCCCGGCCCTCCACACCCGGGGCCAGACCCTCGGGGCCATGCCTTGGTGGGGCCTGTGTCGGGCGTGGGGCCTGCAGGTGGGCGCCCCGACCACGACTTGGCTTCCTTGTGCCTTAAAAAACCTGCCTTCCTGCAGCCACACACCCACCCGGGGTGTCCTGGGGACCCAAGGGGTGGGGGGGTCACACCAGAGAGAGGCAGGGGGCCTGGCCGGCTCCTGCAGGATCATGCAGCTGGGGCGCGGCGGCCGCGGCTGCGACACCCCAACCCCAGCCCTCTAATCAAGTCACGTGATTCTCCCTTCACCCCGCCCCCAGGGCCTTCCCTTCTGCCCCCAGGCGGGCTCCCCGCTGCTCCAGCTGCGGAGCTGGTCGACATAATCTCTGTATTATATACTTTGCAGTTGCAGACGTCTGTGCCTAGCAATATTTCCAGTTGACCAAATATTCTAATCTTTTTTCATTTATATGCAAAAGAAATAGTTTTAAGTAACTTTTTATAGCAAGATGATACAATGGTATGAGTGTAATCTAAACTTCCTTGTGGTATTACCTTGTATGCTGTTACTTTTATTTTATTCCTTGTAATTAAGTCACAGGCAGGACCCAGTTTCCAGAGAGCAGGCGGGGCCGCCCAGTGGGTCAGGCACAGGGAGCCCCGGTCCTATCTTAGAGCCCCTGAGCTTCAGGGAAGGGGCGGGCGTGTCGCCGCCTCTGGCATCGCCTCCGGTTGCCTTACACCACGCCTTCACCTGCAGTCGCCTAGAAAACTTGCTCTCAAACTTCAGGGTTTTTTCTTCCTTCAAATTTTGGACCAAAGTCTCATTTCTGTGTTTTGCCTGCCTCTGATGCTGGGACCCGGAAGGCGGGCGCTCCTCCTGTCTTCTCTGTGCTCTTTCTACCGCCCCCGCGTCCTGTCCCGGGGGCTCTCCTAGGATCCCCTTTCCGTAAAAGCGTGTAACAAGGGTGTAAATATTTATAATTTTTTATACCTGTTGTGAGACCCGAGGGGCGGCGGCGCGGTTTTTTATGGTGACACAAATGTATATTTTGCTAACAGCAATTCCAGGCTCAGTATTGTGACCGCGGAGCCACAGGGGACCCCACGCACATTCCGTTGCCTTACCCGATGGCTTGTGACGCGGAGAGAACCGATTAAAACCGTTTGAGAAACTCCTCCCTTGTCTAGCCCTGTGTTCGCTGTGGACGCTGTAGAGGCAGGTTGGCCAGTCTGTACCTGGACTTCGAATAAATCTTCTGTATCCTCGC