Transcript asmbl_69479

Sequence
Transcript Sequence for observation asmbl_69479 of TGE0059665:
CGCCATTTTGTGAGTCTATAACTCGGAGCCGTTGGGTCGGTTCCTGCTATTCCGGCGCCTCCACTCCGTCCCCCGCGGGTCTGCTCTGTGTGCCATGGACGGCATTGTCCCAGATATAGCCGTTGGTACAAAGCGGGGATCTGACGAGCTTTTCTCTACTTGTGTCACTAACGGACCGTTTATCATGAGCAGCAACTCGGCTTCTGCAGCAAACGGAAATGACAGCAAGAAGTTCAAAGGTGACAGCCGAAGTGCAGGCGTCCCCTCTAGAGTGATCCACATCCGGAAGCTCCCCATCGACGTCACGGAGGGGGAAGTCATCTCCCTGGGGCTGCCCTTTGGGAAGGTCACCAACCTCCTGATGCTGAAGGGGAAAAACCAGGCCTTCATCGAGATGAACACGGAGGAGGCTGCCAACACCATGGTGAACTACTACACCTCGGTGACCCCTGTGCTGCGCGGCCAGCCCATCTACATCCAGTTCTCCAACCACAAGGAGCTGAAGACCGACAGCTCTCCCAACCAGGCGCGGGCCCAGGCGGCCCTGCAGGCGGTGAACTCGGTCCAGTCGGGGAACCTGGCCTTGGCTGCCTCGGCGGCGGCCGTGGACGCAGGGATGGCGATGGCCGGGCAGAGCCCCGTGCTCAGGATCATCGTGGAGAACCTCTTCTACCCTGTGACCCTGGATGTGCTGCACCAGATTTTCTCCAAGTTCGGCACAGTGTTGAAGATCATCACCTTCACCAAGAACAACCAGTTCCAGGCCCTGCTGCAGTATGCGGACCCCGTGAGCGCCCAGCACGCCAAGCTGTCGCTGGACGGGCAGAACATCTACAACGCCTGCTGCACGCTGCGCATCGACTTTTCCAAGCTCACCAGCCTCAACGTCAAGTACAACAATGACAAGAGCCGTGACTACACACGCCCAGACCTGCCTTCCGGGGACAGCCAGCCCTCGCTGGACCAGACCATGGCCGCGGCCTTCGGCCTTTCCGTTCCGAACGTCCACGGCGCCCTGGCCCCCCTGGCCATCCCCTCGGCGGCGGCGGCAGCTGCGGCGGCAGGTCGGATCGCCATCCCGGGCCTGGCGGGGGCAGGAAATTCTGTATTGCTGGTCAGCAACCTCAACCCAGAGGTACGTGGGCTTTTCCTCCGCGCCGCCGTTCCTCCCGGAAGAGCGAGCAGGGGATGTTGTGCTCGGGCTCGGGTCCCGGAGCAGCGCCGCCCCTCGCTGTGTCTGCGCCTCTGCCCTGGCAGCCCCTCTGCTGCAGCGCTGAGACCCTCCTTTTCCAAGATGGCTTGAGTTTTCCTCTTTTCCTGAATTCACATCTTGGTTCGCGTTTTCTCTTGCATGATACGCAGAATGAATTATTTTTTGGTTACCCAAAGGCAATCTAAAAATTACTTGGAGCTGAGCAGGGCGCGCAGTTCAGAGCCCCAGCAGGCCGCCCTGCTGGTCAGCGGGACACACAGGGTTAGCGCGGCGGGGTGTGGGCAGCCCCTGTGGCTCGAGAGCCTGTCACTTAACTGGTGGATCCGTTATTTCCCAGAATGGTTAAATTCCCCTCGGGGAGAGCTTGGGTGAAACAAGAGGCCCAAAATATGTAACTCTTGATGGATGGGATCCTCCTGGAATCAGCATTTCAGGCTGTTCTGTTTCCCGGCAACTCCTGTGACTTCCTCAAGGCGGTGCCCAGCCTGGCCCTCCCTCGCGGGGGCCCAGGACGCACTCCCTGCCTGTGCCTCTTACCACGAGCCGGGTGCTGTCCCTCCAGCTCCTCCTGAGCGAGGCCGTGCACTAACAGACTCGATCTCCCTTCACGCCTGTAATCGTCCTTAGAGACTGACTTGTGCCACAGCTGCGGGAGACAGCGCTGCTGCAGGGCTTGGCTGAGGTGGCCGCGAGCGGAGCTGCACGCGCGCTCCTGGGGGGCGTGGTTGGGATCGGCTTCTGGGAGCCCCTCCAGCAGCGCTGTCTCTGCCGGCATGTGAGTGAAGGTGCTTCTCTTACCGTGTGCCCGTCGAGGTAAACCTGTAACTGGAATGTGTGTGGAGTGTGACTGATAGAACACTACCTGATTCTTATGTATTTACTGACCTGTGTTTTTTTGCTACTTTTTTTCTTTTCTCCCCTTCCCCTTTCCCTATTTTTTTTCTTGCCCTGATCCGGAATTTCTTTGCCAACTGACTGCACGGTACTTCTGCTTCCTGTTGTTGCTTGAAACAAAACAAAAACATAAACAAATAAAAAACAAAAATTCCCCCTCAAACCCTGCTCTCCGGAAACCAACCTGCCCTTGAATATTAACATCCTGACAACTTCATCATCCATCAACCACTGCACGCCTGCGGGGACTGTCTTCCTCGTGTGGACGATTGGCAACTCGCCCCCCTTGACCTCTCCCTCTCCCCTGTCCCTCCGCTGCCTTGCTCTGCTGTCTCTAAAGAGAGTCACACCCCAAAGCCTCTTTATTCTTTTCGGCGTCTACGGTGACGTGCAGCGCGTGAAGATCCTGTTCAATAAGAAGGAGAACGCCCTAGTGCAGATGGCGGACGGCAACCAGGCCCAGCTGGCCATGAGCCACCTGAACGGGCACAAGCTGCACGGGAAGCCCATCCGCATCACGCTCTCGAAGCACCAGAACGTGCAGCTGCCCCGCGAGGGCCAGGAGGACCAGGGCCTGACCAAGGACTACGGCAACTCACCCCTGCACCGCTTCAAGAAGCCGGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTGATCCAGATGGGCTCCGTGGAGGAGGCGGTCCAGGCCCTCATTGACCTGCACAACCACGACCTCGGGGAGAACCACCACCTGCGGGTCTCCTTCTCCAAGTCCACCATCTAGGGGCACAGGCCCCCACGGCCGGGCCCCCTGGCGACAACTTCCATCATTCCAGAGAAAAGCCACTTTAAAAACAGCTGAAGTGACCTTAGCAGACCAGAGATTTTATTTTTTTAAAGAGAAATCAGTTTACCTGTTTTTAAAAAAATTAAATCTAGTTCACCTTGCTCACCCTGCGGTGACAGGGACAGCTCAGGCTCTTGGTGACTGTGGCAGCGGGAGTTCCCGGCCCTCCACACCCGGGGCCAGACCCTCGGGGCCATGCCTTGGTGGGGCCTGTGTCGGGCGTGGGGCCTGCAGGTGGGCGCCCCGACCACGACTTGGCTTCCTTGTGCCTTAAAAAACCTGCCTTCCTGCAGCCACACACCCACCCGGGGTGTCCTGGGGACCCAAGGGGTGGGGGGGTCACACCAGAGAGAGGCAGGGGGCCTGGCCGGCTCCTGCAGGATCATGCAGCTGGGGCGCGGCGGCCGCGGCTGCGACACCCCAACCCCAGCCCTCTAATCAAGTCACGTGATTCTCCCTTCACCCCGCCCCCAGGGCCTTCCCTTCTGCCCCCAGGCGGGCTCCCCGCTGCTCCAGCTGCGGAGCTGGTCGACATAATCTCTGTATTATATACTTTGCAGTTGCAGACGTCTGTGCCTAGCAATATTTCCAGTTGACCAAATATTCTAATCTTTTTTCATTTATATGCAAAAGAAATAGTTTTAAGTAACTTTTTATAGCAAGATGATACAATGGTATGAGTGTAATCTAAACTTCCTTGTGGTATTACCTTGTATGCTGTTACTTTTATTTTATTCCTTGTAATTAAGTCACAGGCAGGACCCAGTTTCCAGAGAGCAGGCGGGGCCGCCCAGTGGGTCAGGCACAGGGAGCCCCGGTCCTATCTTAGAGCCCCTGAGCTTCAGGGAAGGGGCGGGCGTGTCGCCGCCTCTGGCATCGCCTCCGGTTGCCTTACACCACGCCTTCACCTGCAGTCGCCTAGAAAACTTGCTCTCAAACTTCAGGGTTTTTTCTTCCTTCAAATTTTGGACCAAAGTCTCATTTCTGTGTTTTGCCTGCCTCTGATGCTGGGACCCGGAAGGCGGGCGCTCCTCCTGTCTTCTCTGTGCTCTTTCTACCGCCCCCGCGTCCTGTCCCGGGGGCTCTCCTAGGATCCCCTTTCCGTAAAAGCGTGTAACAAGGGTGTAAATATTTATAATTTTTTATACCTGTTGTGAGACCCGAGGGGCGGCGGCGCGGTTTTTTATGGTGACACAAATGTATATTTTGCTAACAGCAATTCCAGGCTCAGTATTGTGACCGCGGAGCCACAGGGGACCCCACGCACATTCCGTTGCCTTACCCGATGGCTTGTGACGCGGAGAGAACCGATTAAAACCGTTTGAGAAACTCCTCCCTTGTCTAGCCCTGTGTTCGCTGTGGACGCTGTAGAGGCAGGTTGGCCAGTCTGTACCTGGACTTCGAATAAATCTTCTGTATCCTCGC