Transcript asmbl_69063

Sequence
Transcript Sequence for observation asmbl_69063 of TGE0058224:
GGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAAGGACCGAAAGGTTCGGCGCAAGGAGCCCAAGAGCCAGGATATCTACCTGAGGCTGTTGGTCAAGTTATACAGGTTTCTGGCCAGAAGAACCAACTCCACATTCAACCAGGTTGTGTTGAAGAGGTTGTTTATGAGTCGCACCAACCGGCCGCCTCTGTCCCTTTCCCGGATGATCCGGAAGATGAAGCTTCCTGGCCGGGAAAACAAGACGGCCGTGGTTGTGGGGACCATAACTGATGATGTGCGGGTTCAGGAGGTACCCAAACTGAAGGTATGTGCACTGCGCGTGACCAGCCGGGCCCGCAGCCGCATCCTCAGGGCAGGGGGCAAGATCCTCACTTTCGACCAGCTGGCCCTGGACTCCCCTAAGGGCTGTGGCACTGTCCTGCTCTCCGGTCCTCGCAAGGGCCGAGAGGTGTACCGGCATTTCGGCAAGGCCCCAGGAACCCCGCACAGCCACACCAAACCCTACGTCCGCTCCAAGGGCCGGAAGTTCGAGCGTGCCAGAGGCCGACGGGCCAGCCGAGGCTACAAAAACTAACCCTGGATCCTACTCTCTTATTAAAAAGATTTTTGCTGACAG