Transcript asmbl_68039

Sequence
Transcript Sequence for observation asmbl_68039 of TGE0001006:
TCTTCCGCCGTCGTCGCCGCCATCCTCGGCGCGACTCGCTTCTTTCGGTTCTACCTGGGAGAATCCACCGCCATCCGCCACCATGGTGAACTTCACGGTAGACCAGATCCGCGCCATCATGGACAAGAAGGCCAACATCCGCAACATGTCTGTCATCGCCCACGTGGACCATGGCAAGTCCACGCTGACAGACTCCCTGGTGTGCAAGGCGGGCATCATCGCCTCGGCCCGGGCCGGGGAGACACGCTTCACTGATACCCGGAAGGACGAGCAGGAGCGTTGCATCACCATCAAGTCAACTGCCATCTCCCTCTTCTACGAGCTCTCGGAGAATGACTTGAACTTCATCAAGCAGAGCAAGGACGGTGCCGGCTTCCTCATCAACCTCATTGACTCCCCCGGGCATGTCGACTTCTCCTCGGAGGTGACTGCTGCCCTCCGAGTCACCGATGGCGCATTGGTGGTGGTGGACTGCGTGTCAGGCGTGTGCGTGCAGACGGAGACAGTGCTGCGGCAGGCCATTGCCGAGCGCATCAAGCCTGTGCTGATGATGAACAAGATGGACCGCGCCCTGCTGGAGCTGCAGCTGGAGCCCGAGGAGCTCTACCAGACTTTCCAGCGCATCGTGGAGAACGTGAACGTCATCATCTCCACCTACGGCGAGGGCGAGAGCGGCCCCATGGGCAACATCATGATCGATCCTGTCCTCGGTACCGTGGGCTTTGGGTCTGGCCTCCACGGGTGGGCCTTCACCCTGAAGCAGTTTGCCGAGATGTATGTGGCCAAGTTCGCCGCCAAGGGGGAGGGCCAGTTGGGGCCTGCCGAGCGGGCCAAGAAAGTAGAGGACATGATGAAGAAGCTGTGGGGTGACAGGTACTTTGACCCAGCCAACGGCAAGTTCAGCAAGTCAGCCACCAGCCCCGAAGGGAAGAAGCTGCCACGCACCTTCTGCCAGCTGATCCTGGACCCCATCTTCAAGGTGTTTGATGCGATCATGAATTTCAAGAAAGAGGAGACAGCAAAACTGATAGAGAAACTGGACATCAAACTGGACAGCGAGGACAAGGACAAAGAAGGCAAACCCCTGCTGAAGGCTGTGATGCGCCGCTGGCTGCCTGCCGGAGACGCCTTGTTGCAGATGATCACCATCCACCTGCCCTCCCCTGTGACGGCCCAGAAGTACCGCTGCGAGCTCCTGTACGAGGGGCCCCCGGACGACGAGGCTGCCATGGGCATTAAAAGCTGTGACCCCAAAGGCCCTCTTATGATGTATATTTCCAAAATGGTGCCAACCTCCGACAAAGGTCGGTTCTACGCCTTTGGACGAGTCTTCTCGGGGCTGGTCTCCACTGGCCTGAAGGTCAGGATCATGGGGCCCAACTATACCCCTGGGAAGAAGGAGGACCTCTACCTGAAGCCAATCCAGAGAACAATCTTGATGATGGGCCGCTACGTGGAGCCCATCGAGGATGTGCCTTGTGGGAACATTGTGGGCCTCGTGGGCGTGGACCAGTTCCTGGTGAAGACGGGCACCATCACCACCTTCGAGCACGCGCACAACATGCGGGTGATGAAGTTCAGCGTCAGCCCTGTTGTCAGAGTGGCCGTGGAGGCCAAGAACCCGGCTGACCTGCCCAAGCTGGTGGAGGGGCTGAAGCGGCTGGCCAAGTCCGACCCCATGGTGCAGTGCATCATCGAGGAGTCGGGAGAGCATATCATCGCGGGCGCCGGCGAGCTGCACCTGGAGATCTGCCTGAAGGACCTGGAGGAGGACCACGCCTGCATCCCCATCAAGAAATCTGACCCGGTCGTCTCGTACCGCGAGACGGTCAGTGAAGAGTCGAACGTGCTCTGCCTCTCCAAGTCCCCCAACAAGCACAACCGGCTGTACATGAAGGCGCGGCCCTTCCCCGACGGCCTGGCCGAGGACATCGATAAAGGCGAGGTGTCCGCCCGTCAGGAGCTCAAGCAGCGGGCGCGCTACCTGGCCGAGAAGTACGAGTGGGACGTGGCTGAGGCCCGCAAGATCTGGTGCTTTGGGCCCGACGGCACCGGCCCCAACATCCTCACCGACATCACCAAGGGTGTGCAGTACCTCAACGAGATCAAGGACAGTGTGGTGGCCGGCTTCCAGTGGGCCACCAAGGAGGGCGCACTGTGTGAGGAGAACATGCGGGGTGTGCGCTTCGACGTCCACGACGTCACCCTGCACGCCGACGCCATCCACCGCGGAGGGGGCCAGATCATCCCCACAGCACGGCGCTGCCTCTATGCCAGTGTGCTGACCGCCCAGCCACGCCTCATGGAGCCCATCTACCTTGTGGAGATCCAGTGTCCAGAGCAGGTGGTCGGTGGCATCTACGGGGTTTTGAACAGGAAGCGGGGCCACGTGTTCGAGGAGTCCCAGGTGGCCGGCACCCCCATGTTTGTGGTCAAGGCCTATCTGCCCGTCAACGAGTCCTTTGGCTTCACCGCTGACCTGAGGTCCAACACGGGCGGCCAGGCGTTCCCCCAGTGTGTGTTTGACCACTGGCAGATCCTGCCCGGAGACCCCTTCGACAACAGCAGCCGCCCCAGCCAGGTGGTGGCGGAGACCCGCAAGCGCAAGGGCCTGAAAGAAGGCATCCCTGCCCTGGACAACTTCCTGGACAAATTGTAGGCGGCCCTTCCTGCAGCGCCTGCCGCCCCGGGGACTCGCAGCACCCACAGCACCACGTCCTCGAATTCTCAGACGACACCTGGAGACTGTCCCGACACAGCGACGCTCCCCTGAGAGGTTTCTGGGGCCCGCTGCGTGCCATCACTCAACCATAACACTTGATGCCGTTTCTTTCAATATTTATTTCCAGAGTCCGGAGGCAGCAGACACGCCCTCTTAGTAGGGACTTAATGGGCCGGTCGGGGAGGGGGAGGCGGGATGGGACACCCAACACTTTTTCCATTTCTTCAGAGGGAAACTCAGATGTCCAAACTAATTTTAACAAACGCATTAAGAGGTTTATTTGGGTACATGGCCCGCAGTGGCTTTTGCCCCAGAAAGGGGAAAGGAACACGCGGGTAGATGATTTCTAGCAGGCAGGAAGTCCTGTGCGGTGTCACCATGAGCACCTCCAGCTGTACTAGTGCCATTGGAATAATAAATTTGATAAGGTGGTGACTCTGTTCTGCATTTTTCACGGTGTCTTCGCAGGGGAGCGGGGCTGCCCAGTACTGGGCTCCCTGGAGCCTAGAAGGGGACCC