Transcript asmbl_67750

Sequence
Transcript Sequence for observation asmbl_67750 of TGE0000989:
TCCCGCCCCCAGCTGGCGGCCGCGGCCGCCCGCGCGCCAAGTTCCTCAGCCCTTGGCTCCTGCCCAGTGTTTAGGGTGTTGGCGGAGACAAAGGGGAAGAGTCATCGCCTGTCGGGGCTAGGATATGATGGGTGAGAGGTGTCAAACCAAATTCTCTCGGTTTGGAAACGGAGAAAATCTAAAAATGAGGATGTGAGGAAAGAGTCCGCTCTCAAGGCGCGTTGTGGTCTATCCGAGCCCCGTCCCCTGGGCTCCCTCGGGCTGGGGTGAGGCGGGCAGCGCTACGCGTGGGGTAGGACCATCTTACGCTGGGACCCCGCCAAGGAGCCCCAGGAAGTAGGTGAAAGGGCAGGGGCGTGGCTCTCGGGGCGCCACCCACGCTCTTGAAATCTGGGTGATTGCGAGCGGCCGCTCAGCGTCCCCCACACCACAGACCCGCGCCGCCGACGACCCAGCAGCCGCCATGGCTCTGCTCCGAGGTGTGTTTGTAGTTGCTGCTAAGCGAACGCCCTTTGGAGCTTACGGAGGCCTTCTGAAAGACTTCACTGCTACTGACTTGTCTGAATTTGCTGCCAAGGCTGCCTTGTCTGCTGGCAAAGTCTCACCTGAAACAGTTGACAGTGTGATTATGGGCAATGTCCTGCAGAGTTCTTCAGATGCTATATATTTGGCAAGGCATGTTGGTTTGCGTGTGGGAATCCCAAAGGAGACCCCAGCTCTCACGATTAATAGGCTCTGTGGTTCTGGTTTTCAGTCCATTGTGAATGGATGTCAGGAAATTTGTGTTAAAGAAGCTGAAGTTGTTTTATGTGGAGGAACCGAAAGCATGAGCCAAGCTCCCTACTGTGTCAGAAATGTGCGTTTTGGAACCAAGCTTGGATCAGATATCAAGCTGGAAGATTCTTTATGGGTATCATTAACAGATCAGCATGTCCAGCTCCCCATGGCAATGACTGCAGAGAATCTTGCTGTAAAACACAAAATAAGCAGAGAAGAATGTGACAAATATGCCCTGCAGTCACAGCAGAGATGGAAAGCTGCTAATGATGCTGGCTACTTTAATGATGAAATGGCACCAATTGAAGTGAAGACAAAGAAAGGAAAACAGACAATGCAGGTAGACGAGCATGCTCGGCCCCAAACCACCCTGGAACAGTTACAGAAACTTCCTCCAGTATTCAAGAAAGATGGAACTGTTACTGCAGGGAATGCATCGGGTGTAGCTGATGGTGCTGGAGCTGTTATCATAGCTAGTGAAGATGCTGTTAAGAAACATAACTTCACACCACTGGCAAGAATTGTGGGCTACTTTGTATCTGGATGTGATCCCTCTATCATGGGTATTGGTCCTGTCCCTGCTATCAGTGGGGCACTGAAGAAAGCAGGACTGAGTCTTAAGGACATGGATTTGGTAGAGGTGAATGAAGCTTTTGCTCCCCAGTACTTGGCTGTTGAGAGGAGTTTGGATCTTGACATAAGTAAAACCAATGTGAATGGAGGAGCCATTGCTTTGGGTCACCCACTGGGAGGATCTGGATCAAGAATTACTGCACACCTGGTTCACGAATTAAGGCGTCGAGGTGGAAAATATGCCGTTGGATCAGCTTGCATTGGAGGTGGCCAAGGTATTGCTGTCATCATTCAGAGCACAGCCTGAAGAGACCAGTGAGCTCACTGTGACCCATCCTTACTCTACTTGGCCAGGCCACAGTAAAACAAGTGACCTTCAGAGCAGCTGCCACAACTGGCCATGCCCTGCCATTGAAACAGTGATTAAGTTTGATCAAGCCATGGTGACACAAAAATGCATTGATCATGAATAGGAGCCCATGCTAGAAGTACATTCTCTCAGATTTGAACCAGTGAAATATGATGTATTTCTGAGCTAAAACTCAACTATAGAAGACATTAAAAGAAATCGTATTCTTGCCAAGTAACCACCACTTCTGCCTTAGATAATATGATTATAAGGAAATCAAATAAATGTTGCCTTAACTTCAGTTAATATTTTCCTGTCATTTATATTTTTAAAAATTTTAAATTGTGATAAGATACACATTACATAAACTTTACCATCTTAACCCTTTTTTAGCGTACAATTCACTGGTATTAAGTACATTCACATTTTTATACAAACATCCCCACTTTTTATCAACAGAACTTTTTCAGTCACCACACATGGAAACAATAACTCCTGATTCTCCCATCCCCCATCCCCTGACAACCACCAGTGTATTTTGTTTCTATAAATTTGATGACTCGAGGTACCTCATAAGTGAAATTATAAATATCTGTCCTTTCGTGACTGGCTTATTTTACTTTACTTTATATAATGTTCTCAAGATTCATCCACCTTATGGTGTAGCATGTGTCAGAATTTCCTTCTTTTTAAAGGCTGAATAATA