Transcript asmbl_67749

Sequence
Transcript Sequence for observation asmbl_67749 of TGE0059663:
TCCCGCCCCCAGCTGGCGGCCGCGGCCGCCCGCGCGCCAAGTTCCTCAGCCCTTGGCTCCTGCCCAGTGTTTAGGGTGTTGGCGGAGACAAAGGGGAAGAGTCATCGCCTGTCGGGGCTAGGATATGATGGGTGAGAGGTGTCAAACCAAATTCTCTCGGTTTGGAAACGGAGAAAATCTAAAAATGAGGATGTGAGGAAAGAGTCCGCTCTCAAGGCGCGTTGTGGTCTATCCGAGCCCCGTCCCCTGGGCTCCCTCGGGCTGGGGTGTGTTTGTAGTTGCTGCTAAGCGAACGCCCTTTGGAGCTTACGGAGGCCTTCTGAAAGACTTCACTGCTACTGACTTGTCTGAATTTGCTGCCAAGGCTGCCTTGTCTGCTGGCAAAGTCTCACCTGAAACAGTTGACAGTGTGATTATGGGCAATGTCCTGCAGAGTTCTTCAGATGCTATATATTTGGCAAGGCATGTTGGTTTGCGTGTGGGAATCCCAAAGGAGACCCCAGCTCTCACGATTAATAGGCTCTGTGGTTCTGGTTTTCAGTCCATTGTGAATGGATGTCAGGAAATTTGTGTTAAAGAAGCTGAAGTTGTTTTATGTGGAGGAACCGAAAGCATGAGCCAAGCTCCCTACTGTGTCAGAAATGTGCGTTTTGGAACCAAGCTTGGATCAGATATCAAGCTGGAAGATTCTTTATGGGTATCATTAACAGATCAGCATGTCCAGCTCCCCATGGCAATGACTGCAGAGAATCTTGCTGTAAAACACAAAATAAGCAGAGAAGAATGTGACAAATATGCCCTGCAGTCACAGCAGAGATGGAAAGCTGCTAATGATGCTGGCTACTTTAATGATGAAATGGCACCAATTGAAGTGAAGACAAAGAAAGGAAAACAGACAATGCAGGTAGACGAGCATGCTCGGCCCCAAACCACCCTGGAACAGTTACAGAAACTTCCTCCAGTATTCAAGAAAGATGGAACTGTTACTGCAGGGAATGCATCGGGTGTAGCTGATGGTGCTGGAGCTGTTATCATAGCTAGTGAAGATGCTGTTAAGAAACATAACTTCACACCACTGGCAAGAATTGTGGGCTACTTTGTATCTGGATGTGATCCCTCTATCATGGGTATTGGTCCTGTCCCTGCTATCAGTGGGGCACTGAAGAAAGCAGGACTGAGTCTTAAGGACATGGATTTGGTAGAGGTGAATGAAGCTTTTGCTCCCCAGTACTTGGCTGTTGAGAGGAGTTTGGATCTTGACATAAGTAAAACCAATGTGAATGGAGGAGCCATTGCTTTGGGTCACCCACTGGGAGGATCTGGATCAAGAATTACTGCACACCTGGTTCACGAATTAAGGCGTCGAGGTGGAAAATATGCCGTTGGATCAGCTTGCATTGGAGGTGGCCAAGGTATTGCTGTCATCATTCAGAGCACAGCCTGAAGAGACCAGTGAGCTCACTGTGACCCATCCTTACTCTACTTGGCCAGGCCACAGTAAAACAAGTGACCTTCAGAGCAGCTGCCACAACTGGCCATGCCCTGCCATTGAAACAGTGATTAAGTTTGATCAAGCCATGGTGACACAAAAATGCATTGATCATGAATAGGAGCCCATGCTAGAAGTACATTCTCTCAGATTTGAACCAGTGAAATATGATGTATTTCTGAGCTAAAACTCAACTATAGAAGACATTAAAAGAAATCGTATTCTTGCCAAGTAACCACCACTTCTGCCTTAGATAATATGATTATAAGGAAATCAAATAAATGTTGCCTTAACTTCAGTTAATATTTTCCTGTCATTTATATTTTTAAAAATTTTAAATTGTGATAAGATACACATTACATAAACTTTACCATCTTAACCCTTTTTTAGCGTACAATTCACTGGTATTAAGTACATTCACATTTTTATACAAACATCCCCACTTTTTATCAACAGAACTTTTTCAGTCACCACACATGGAAACAATAACTCCTGATTCTCCCATCCCCCATCCCCTGACAACCACCAGTGTATTTTGTTTCTATAAATTTGATGACTCGAGGTACCTCATAAGTGAAATTATAAATATCTGTCCTTTCGTGACTGGCTTATTTTACTTTACTTTATATAATGTTCTCAAGATTCATCCACCTTATGGTGTAGCATGTGTCAGAATTTCCTTCTTTTTAAAGGCTGAATAATATTC