Transcript asmbl_67748

Sequence
Transcript Sequence for observation asmbl_67748 of TGE0059663:
TCCCGCCCCCAGCTGGCGGCCGCGGCCGCCCGCGCGCCAAGTTCCTCAGCCCTTGGCTCCTGCCCAGTGTTTAGGGTGTTGGCGGAGACAAAGGGGAAGAGTCATCGCCTGTCGGGGCTAGGATATGATGGGTGAGAGGTGTCAAACCAAATTCTCTCGGTTTGGAAACGGAGAAAATCTAAAAATGAGGATGTGAGGAAAGAGTCCGCTCTCAAGGTGTGTTTGTAGTTGCTGCTAAGCGAACGCCCTTTGGAGCTTACGGAGGCCTTCTGAAAGACTTCACTGCTACTGACTTGTCTGAATTTGCTGCCAAGGCTGCCTTGTCTGCTGGCAAAGTCTCACCTGAAACAGTTGACAGTGTGATTATGGGCAATGTCCTGCAGAGTTCTTCAGATGCTATATATTTGGCAAGGCATGTTGGTTTGCGTGTGGGAATCCCAAAGGAGACCCCAGCTCTCACGATTAATAGGCTCTGTGGTTCTGGTTTTCAGTCCATTGTGAATGGATGTCAGGAAATTTGTGTTAAAGAAGCTGAAGTTGTTTTATGTGGAGGAACCGAAAGCATGAGCCAAGCTCCCTACTGTGTCAGAAATGTGCGTTTTGGAACCAAGCTTGGATCAGATATCAAGCTGGAAGATTCTTTATGGGTATCATTAACAGATCAGCATGTCCAGCTCCCCATGGCAATGACTGCAGAGAATCTTGCTGTAAAACACAAAATAAGCAGAGAAGAATGTGACAAATATGCCCTGCAGTCACAGCAGAGATGGAAAGCTGCTAATGATGCTGGCTACTTTAATGATGAAATGGCACCAATTGAAGTGAAGACAAAGAAAGGAAAACAGACAATGCAGGTAGACGAGCATGCTCGGCCCCAAACCACCCTGGAACAGTTACAGAAACTTCCTCCAGTATTCAAGAAAGATGGAACTGTTACTGCAGGGAATGCATCGGGTGTAGCTGATGGTGCTGGAGCTGTTATCATAGCTAGTGAAGATGCTGTTAAGAAACATAACTTCACACCACTGGCAAGAATTGTGGGCTACTTTGTATCTGGATGTGATCCCTCTATCATGGGTATTGGTCCTGTCCCTGCTATCAGTGGGGCACTGAAGAAAGCAGGACTGAGTCTTAAGGACATGGATTTGGTAGAGGTGAATGAAGCTTTTGCTCCCCAGTACTTGGCTGTTGAGAGGAGTTTGGATCTTGACATAAGTAAAACCAATGTGAATGGAGGAGCCATTGCTTTGGGTCACCCACTGGGAGGATCTGGATCAAGAATTACTGCACACCTGGTTCACGAATTAAGGCGTCGAGGTGGAAAATATGCCGTTGGATCAGCTTGCATTGGAGGTGGCCAAGGTATTGCTGTCATCATTCAGAGCACAGCCTGAAGAGACCAGTGAGCTCACTGTGACCCATCCTTACTCTACTTGGCCAGGCCACAGTAAAACAAGTGACCTTCAGAGCAGCTGCCACAACTGGCCATGCCCTGCCATTGAAACAGTGATTAAGTTTGATCAAGCCATGGTGACACAAAAATGCATTGATCATGAATAGGAGCCCATGCTAGAAGTACATTCTCTCAGATTTGAACCAGTGAAATATGATGTATTTCTGAGCTAAAACTCAACTATAGAAGACATTAAAAGAAATCGTATTCTTGCCAAGTAACCACCACTTCTGCCTTAGATAATATGATTATAAGGAAATCAAATAAATGTTGCCTTAACTTCAGTTAATATTTTCCTGTCATTTATATTTTTAAAAATTTTAAATTGTGATAAGATACACATTACATAAACTTTACCATCTTAACCCTTTTTTAGCGTACAATTCACTGGTATTAAGTACATTCACATTTTTATACAAACATCCCCACTTTTTATCAACAGAACTTTTTCAGTCACCACACATGGAAACAATAACTCCTGATTCTCCCATCCCCCATCCCCTGACAACCACCAGTGTATTTTGTTTCTATAAATTTGATGACTCGAGGTACCTCATAAGTGAAATTATAAATATCTGTCCTTTCGTGACTGGCTTATTTTACTTTACTTTATATAATGTTCTCAAGATTCATCCACCTTATGGTGTAGCATGTGTCAGAATTTCCTTCTTTTTAAAGGCTGAATAATATTC