Transcript asmbl_67747

Sequence
Transcript Sequence for observation asmbl_67747 of TGE0059662:
TCCCGCCCCCAGCTGGCGGCCGCGGCCGCCCGCGCGCCAAGTTCCTCAGCCCTTGGCTCCTGCCCAGTGTTTAGGGTGTTGGCGGAGACAAAGGGGAAGAGTCATCGCCTGTCGGGGCTAGGATATGATGGGTGTGTTTGTAGTTGCTGCTAAGCGAACGCCCTTTGGAGCTTACGGAGGCCTTCTGAAAGACTTCACTGCTACTGACTTGTCTGAATTTGCTGCCAAGGCTGCCTTGTCTGCTGGCAAAGTCTCACCTGAAACAGTTGACAGTGTGATTATGGGCAATGTCCTGCAGAGTTCTTCAGATGCTATATATTTGGCAAGGCATGTTGGTTTGCGTGTGGGAATCCCAAAGGAGACCCCAGCTCTCACGATTAATAGGCTCTGTGGTTCTGGTTTTCAGTCCATTGTGAATGGATGTCAGGAAATTTGTGTTAAAGAAGCTGAAGTTGTTTTATGTGGAGGAACCGAAAGCATGAGCCAAGCTCCCTACTGTGTCAGAAATGTGCGTTTTGGAACCAAGCTTGGATCAGATATCAAGCTGGAAGATTCTTTATGGGTATCATTAACAGATCAGCATGTCCAGCTCCCCATGGCAATGACTGCAGAGAATCTTGCTGTAAAACACAAAATAAGCAGAGAAGAATGTGACAAATATGCCCTGCAGTCACAGCAGAGATGGAAAGCTGCTAATGATGCTGGCTACTTTAATGATGAAATGGCACCAATTGAAGTGAAGACAAAGAAAGGAAAACAGACAATGCAGGTAGACGAGCATGCTCGGCCCCAAACCACCCTGGAACAGTTACAGAAACTTCCTCCAGTATTCAAGAAAGATGGAACTGTTACTGCAGGGAATGCATCGGGTGTAGCTGATGGTGCTGGAGCTGTTATCATAGCTAGTGAAGATGCTGTTAAGAAACATAACTTCACACCACTGGCAAGAATTGTGGGCTACTTTGTATCTGGATGTGATCCCTCTATCATGGGTATTGGTCCTGTCCCTGCTATCAGTGGGGCACTGAAGAAAGCAGGACTGAGTCTTAAGGACATGGATTTGGTAGAGGTGAATGAAGCTTTTGCTCCCCAGTACTTGGCTGTTGAGAGGAGTTTGGATCTTGACATAAGTAAAACCAATGTGAATGGAGGAGCCATTGCTTTGGGTCACCCACTGGGAGGATCTGGATCAAGAATTACTGCACACCTGGTTCACGAATTAAGGCGTCGAGGTGGAAAATATGCCGTTGGATCAGCTTGCATTGGAGGTGGCCAAGGTATTGCTGTCATCATTCAGAGCACAGCCTGAAGAGACCAGTGAGCTCACTGTGACCCATCCTTACTCTACTTGGCCAGGCCACAGTAAAACAAGTGACCTTCAGAGCAGCTGCCACAACTGGCCATGCCCTGCCATTGAAACAGTGATTAAGTTTGATCAAGCCATGGTGACACAAAAATGCATTGATCATGAATAGGAGCCCATGCTAGAAGTACATTCTCTCAGATTTGAACCAGTGAAATATGATGTATTTCTGAGCTAAAACTCAACTATAGAAGACATTAAAAGAAATCGTATTCTTGCCAAGTAACCACCACTTCTGCCTTAGATAATATGATTATAAGGAAATCAAATAAATGTTGCCTTAACTTCAGTTAATATTTTCCTGTCATTTATATTTTTAAAAATTTTAAATTGTGATAAGATACACATTACATAAACTTTACCATCTTAACCCTTTTTTAGCGTACAATTCACTGGTATTAAGTACATTCACATTTTTATACAAACATCCCCACTTTTTATCAACAGAACTTTTTCAGTCACCACACATGGAAACAATAACTCCTGATTCTCCCATCCCCCATCCCCTGACAACCACCAGTGTATTTTGTTTCTATAAATTTGATGACTCGAGGTACCTCATAAGTGAAATTATAAATATCTGTCCTTTCGTGACTGGCTTATTTTACTTTACTTTATATAATGTTCTCAAGATTCATCCACCTTATGGTGTAGCATGTGTCAGAATTTCCTTCTTTTTAAAGGCTGAATAATATTC