Transcript asmbl_67269

Sequence
Transcript Sequence for observation asmbl_67269 of TGE0059661:
GGGTCGGCCCCGGGACGCGCGCAGCCGGCCCGCAGTTGCCGCTGTCGTCCGCAGAGCCAGTTCCTAGCGCAGAGCCGCGCCCGCCATGAGGGAGATCGTGCACATCCAGGCGGGCCAGTGCGGGAACCAGATCGGCACCAAGTTTTGGGAAGTGATCAGCGATGAGCACGGCATCGACCCGGCCGGAGGCTACGTGGGAGACTCGGCGCTGCAGCTGGAGAGAATCAACGTCTACTACAATGAGTCATCGTCTCAGAAATATGTGCCCAGGGCCGCCCTGGTGGACTTAGAGCCAGGCACCATGGACAGCGTGCGGTCTGGGCCTTTTGGGCAGCTTTTCCGGCCTGACAACTTCATCTTTGGCCAGACGGGTGCAGGGAACAACTGGGCGAAAGGGCACTACACGGAGGGCGCGGAGCTGGTGGACGCAGTGCTGGACGTGGTGCGGAAGGAGTGCGAGCACTGCGACTGCCTGCAGGGCTTCCAGCTCACGCACTCGCTGGGCGGCGGCACGGGCTCAGGCATGGGCACGCTGCTCATCAGCAAGATCCGTGAGGAGTTCCCGGACCGCATCATGAACACCTTCAGCGTCATGCCCTCGCCCAAGGTGTCGGACACGGTGGTGGAGCCCTACAATGCCACACTGTCGGTGCACCAGCTGGTGGAGAATACAGACGAGACCTACTGCATCGACAACGAGGCGCTCTATGACATCTGCTTCCGCACTCTGAAGCTGACAACG