Transcript asmbl_67241

Sequence
Transcript Sequence for observation asmbl_67241 of TGE0059660:
GGTCGGGAGCGCGCACGCTGTGCGCCCTGGGCGCGCTCGGGATTCTCGCCTGGCGCGGCTGGGGAAGGTGAACAGTGTGGCCCGCCATGTTCTTCTCCGCGGCGCTCCGGGCCCGGGCGGCTGGCCTCACCGCCCACTGGGGAAGACATGTAAGGAATTTGCATAAGACAGTTATGCAAAATGGAGCTGGAGGAGCTTTATTTGTGCACAGAGATACTCCTGAGAATAACCCTGATACTCCATTTGATTTCACACCAGAAAACTATAAGAGGATAGAGGCAATTGTAAAAAACTATCCAGAAGGCCATAAAGCAGCAGCTGTTCTTCCAGTCCTGGATTTAGCCCAAAGGCAGAATGGGTGGTTGCCCATCTCTGCTATGAACAAGGTTGCAGAAGTTTTACAAGTACCTCCAATGAGAGTATATGAAGTAGCAACTTTTTATACAATGTATAATCGAAAGCCAGTTGGAAAGTATCACATTCAGGTCTGCACTACTACACCCTGCATGCTTCGAAACTCTGACAGCATACTGGAGGCCATTCAGAAAAAGCTTGGAATAAAGGTTGGGGAGACTACACCTGACAAACTTTTCACTCTTATAGAAGTGGAATGTTTAGGGGCCTGTGTGAACGCACCAATGGTTCAAATAAATGACAATTACTATGTGAGTATTTCAGGAGGATTTGACAGCTAAGGATATTGAAGAAATTATTGATGAGCTCAAGGCTGGCAAAATCCCAAAACCAGGGCCAAGGAGTGGACGCTTCTCTTGTGAGCCAGCTGGAGGTCTTACCTCTTTGACTGAACCACCCAAGGGACCTGGATTTGGTGTACAAGCAGGCCTTTAATTTATATTGAACTGTAAATATGTCACTAGAGAAATAAAATATGGACTTCCAATCTACGTAAACTTATTTGTTTATTCTGCTCTGTGTACATCCTCAT