Transcript asmbl_67240

Sequence
Transcript Sequence for observation asmbl_67240 of TGE0000956:
GGTCGGGAGCGCGCACGCTGTGCGCCCTGGGCGCGCTCGGGATTCTCGCCTGGCGCGGCTGGGGAAGGTGAACAGTGTGGCCCGCCATGTTCTTCTCCGCGGCGCTCCGGGCCCGGGCGGCTGGCCTCACCGCCCACTGGGGAAGACATGTAAGGAATTTGCATAAGACAGTTATGCAAAATGGAGCTGGAGGAGCTTTATTTGTGCACAGAGATACTCCTGAGAATAACCCTGATACTCCATTTGATTTCACACCAGAAAACTATAAGAGGATAGAGGCAATTGTAAAAAACTATCCAGAAGGCCATAAAGCAGCAGCTGTTCTTCCAGTCCTGGATTTAGCCCAAAGGCAGAATGGGTGGTTGCCCATCTCTGCTATGAACAAGGTTGCAGAAGTTTTACAAGTACCTCCAATGAGAGTATATGAAGTAGCAACTTTTTATACAATGTATAATCGAAAGCCAGTTGGAAAGTATCACATTCAGGTCTGCACTACTACACCCTGCATGCTTCGAAACTCTGACAGCATACTGGAGGCCATTCAGAAAAAGCTTGGAATAAAGGTTGGGGAGACTACACCTGACAAACTTTTCACTCTTATAGAAGTGGAATGTTTAGGGGCCTGTGTGAACGCACCAATGGTTCAAATAAATGACAATTACTATGAGGATTTGACAGCTAAGGATATTGAAGAAATTATTGATGAGCTCAAGGCTGGCAAAATCCCAAAACCAGGGCCAAGGAGTGGACGCTTCTCTTGTGAGCCAGCTGGAGGTCTTACCTCTTTGACTGAACCACCCAAGGGACCTGGATTTGGTGTACAAGCAGGCCTTTAATTTATATTGAACTGTAAATATGTCACTAGAGAAATAAAATATGGACTTCCAATCTACGTAAACTTATTTGTTTATTCTGCTCTGTGTACATCCTCAT