Transcript asmbl_67213

Sequence
Transcript Sequence for observation asmbl_67213 of TGE0059659:
TCAAGATCCGCTCCCGGGATACGCGCACTGCTCCGGGGCCCTCAGGCGGAGACCCAGACCCCGCGCGGGGCGTCAAGCGCAGGCGCACTACCGCCCACAAGCTGGAGCCCGGCTTCGGGGCGGGGCGAGGGTCAGTCACGTGGGCCCGCAGCCCTCTCCTCGATTTCCCTACAAGGACTTGGGCCGACGGGCCCCGCCCTTCGCCGTGCCCTGGAATGTGCGGCCAGGCAAAGCCACAGGACGGACGCAACCATCTGCGGAAAGGATAGGGGGGAGGAAGACTTAACACTGCAACAACAGGACTTAACCACCACCATGTCGAGCAAAAGAACAAAGACCAAGACCAAGAAGCGCCCTCAGCGTGCAACATCCAATGTGTTTGCTATGTTTGACCAGTCACAGATTCAGGAGTTCAAAGAGGCCTTCAACATGATTGATCAGAACAGAGATGGTTTCATCGACAAGGAAGATTTGCATGATATGCTTGCTTCATTGGGGAAGAATCCAACTGATGAGTATCTAGATGCCATGATGAATGAGGCTCCAGGCCCCATCAATTTCACCATGTTCCTCACCATGTTTGGTGAGAAGTTAAATGGCACAGATCCTGAAGATGTCATCAGAAATGCCTTTGCTTGCTTTGATGAAGAAGCAACTGGCACCATACAGGAAGATTACTTGAGAGAGCTGCTGACAACCATGGGGGATCGGTTTACAGATGAGGAAGTGGATGAGCTGTACAGAGAAGCACCTATTGATAAAAAGGGGAATTTCAATTACATCGAGTTCACACGCATCCTGAAACATGGAGCCAAAGACAAAGATGACTGAAATAACTTCAAATTCCAGCCAAACGTTCCTTGTTGCCACTTTGGGTATTCTGAGATTTTCTCTTGCATGCCCTTAGCTTTACAGCTTTTGCATTTCCTGTTGTATTTATTCTCAGCCATTTTGGGCATATGTATCTTTATAATCAGACTGGAAACGGGACTTTCTATTAATATCATTTTCAGAATAAAAAATAGGATAATTTAACCTACCAGCCCTTCTCCCCCAATAACTGTGGTCTATACAGAGTCAATATATTTTTTCAGAGAAAGTTATTCGCTCGATTTTTTCTGAATCATAATTAAACTTTATGATAAAATA