Transcript asmbl_64799

Sequence
Transcript Sequence for observation asmbl_64799 of TGE0000941:
GTCCCGGCTCGGGCGGCGGCGCGCACGAGCATCACCCCACCGGCGGCGGCGCGCCGGGTCCCGGGGCGCAGCCCCGACGCTCATTGGCCTGGGCGGCGCAGCCAAGCTGTCAGCCCATGTGGCGTGGCCGCCCGGGGATGGCCGCGGTTTAAATAGCGTCGGCGCCGGCCTAGAGGGAGCCAGAGAGACGGCAGCGGCCCCGGCCTCCCTCTCCGCCGCGCTTCAGCCTCCCGCTCCGCCGCGCTCCAGCCTCGCTCTCCGCCGCCCGCACCGCCGCCCGCGCCCTCACCAGAGCAGCCATGGAGGAGGTGGTGATTGCCGGCATGTCCGGGAAGCTGCCAGAGTCGGAGAACTTGCAGGAGTTCTGGGACAACCTCATCGGCGGTGTGGACATGGTCACGGACGATGACCGTCGCTGGAAGGCGGGGCTCTACGGCCTGCCCCGGCGGTCCGGCAAGCTGAAGGACCTGTCTAGGTTTGATGCCTCCTTCTTCGGAGTCCACCCCAAGCAGGCACACACGATGGACCCTCAGCTGCGGCTGCTGCTGGAAGTCACCTATGAAGCCATCGTGGACGGAGGCATCAACCCAGATTCACTCCGAGGAACACACACTGGCGTCTGGGTGGGCGTGAGCGGCTCTGAGACCTCGGAGGCCCTGAGCCGAGACCCCGAGACACTCGTGGGCTACAGCATGGTGGGCTGCCAGCGAGCGATGATGGCCAACCGGCTCTCCTTCTTCTTCGACTTCAGAGGGCCCAGCATCGCACTGGACACAGCCTGCTCCTCCAGCCTGATGGCCCTGCAGAACGCCTACCAGGCCATCCACAGCGGGCAGTGCCCTGCCGCCATCGTGGGGGGCATCAATGTCCTGCTGAAGCCCAACACCTCCGTGCAGTTCTTGAGGCTGGGGATGCTCAGCCCCGAGGGCACCTGCAAGGCCTTCGACACAGCGGGGAATGGGTACTGCCGCTCGGAGGGTGTGGTGGCCGTCCTGCTGACCAAGAAGTCCCTGGCCCGGCGGGTGTACGCCACCATCCTGAACGCCGGCACCAATACAGATGGCTTCAAGGAGCAAGGCGTGACCTTCCCCTCAGGGGATATCCAGGAGCAGCTCATCCGCTCGTTGTACCAGTCGGCCGGAGTGGCCCCTGAGTCATTTGAATACATCGAAGCCCACGGCACAGGCACCAAGGTGGGCGACCCCCAGGAGCTGAATGGCATCACCCGAGCCCTGTGCGCCACCCGCCAGGAGCCGCTGCTCATCGGCTCCACCAAGTCCAACATGGGGCACCCGGAGCCAGCCTCGGGGCTGGCAGCCCTGGCCAAGGTGCTGCTGTCCCTGGAGCACGGGCTCTGGGCCCCCAACCTGCACTTCCATAGCCCCAACCCTGAGATCCCAGCGCTGTTGGATGGGCGGCTGCAGGTGGTGGACCAGCCCCTGCCCGTCCGTGGCGGCAACGTGGGCATCAACTCCTTTGGCTTCGGGGGCTCCAACGTGCACATCATCCTGAGGCCCAACACGCAGCCGCCCCCCGCACCCGCCCCACATGCCACCCTGCCCCGTCTGCTGCGGGCCAGCGGACGCACCCCTGAGGCCGTGCAGAAGCTGCTGGAGCAGGGCCTCCGGCACAGCCAGGACCTGGCTTTCCTGAGCATGCTGAACGACATCGCGGCTGTCCCCGCCACCGCCATGCCCTTCCGTGGCTACGCTGTGCTGGGTGGTGAGCGCGGTGGCCCAGAGGTGCAGCAGGTGCCCGCTGGCGAGCGCCCGCTCTGGTTCATCTGCTCTGGGATGGGCACACAGTGGCGCGGGATGGGGCTGAGCCTCATGCGCCTGGACCGCTTCCGAGATTCCATCCTACGCTCCGATGAGGCTGTGAAGCCATTCGGCCTGAAGGTGTCACAGCTGCTGCTGAGCACAGACGAGAGCACCTTTGATGACATCGTCCATTCGTTTGTGAGCCTGACTGCCATCCAGATAGGCCTCATAGACCTGCTGAGCTGCATGGGGCTGAGGCCAGATGGCATCGTCGGCCACTCCCTGGGGGAGGTGGCCTGTGGCTACGCCGACGGCTGCCTGTCCCAGGAGGAGGCCGTCCTCGCTGCCTACTGGAGGGGACAGTGCATCAAAGAAGCCCATCTCCCGCCGGGCGCCATGGCAGCCGTGGGCTTGTCCTGGGAGGAGTGTAAACAGCGCTGCCCCCCGGGCGTGGTGCCCGCCTGCCACAACTCCAAGGACACAGTCACCATCTCGGGACCTCAGGCCCCGGTGTTTGAGTTCGTGGAGCAGCTGAGGAAGGAGGGTGTGTTTGCCAAGGAGGTGCGGACCGGCGGTATGGCCTTCCACTCCTACTTCATGGAGGCCATCGCACCCCCACTGCTGCAGGAGCTCAAGAAGGTGATCCGGGAGCCGAAGCCACGTTCAGCCCGCTGGCTCAGCACCTCTATCCCCGAGGCCCAGTGGCACAGCAGCCTGGCACGCACGTCCTCCGCCGAGTACAATGTCAACAACCTGGTGAGCCCTGTGCTGTTCCAGGAGGCCCTGTGGCACGTGCCTGAGCACGCGGTGGTGCTGGAGATCGCGCCCCACGCCCTGCTGCAGGCTGTCCTGAAGCGTGGCCTGAAGCCGAGCTGCACCATCATCCCCCTGATGAAGAAGGATCACAGGGACAACCTGGAGTTCTTCCTGGCCGGCATCGGCAGGCTGCACCTCTCAGGCATCGACGCCAACCCCAATGCCTTGTTCCCACCTGTGGAGTTCCCAGCTCCCCGAGGAACTCCCCTCATCTCCCCACTCATCAAGTGGGACCACAGCCTGGCCTGGGACGTGCCGGCCGCCGAGGACTTCCCCAACGGTTCAGGTTCCCCCTCAGCCGCCATCTACAACATCGACACCAGCTCCGAGTCTCCTGACCACTACCTGGTGGACCACACCCTCGACGGTCGCGTCCTCTTCCCCGCCACTGGCTACCTGAGCATAGTGTGGAAGACGCTGGCCCGCGCCCTGGGCCTGGGCGTCGAGCAGCTGCCTGTGGTGTTTGAGGATGTGGTGCTGCACCAGGCCACCATCCTGCCCAAGACTGGGACAGTGTCCCTGGAGGTACGGCTCCTGGAGGCCTCCCGTGCCTTCGAGGTGTCAGAGAACGGCAACCTGGTAGTGAGTGGGAAGGTGTACCAGTGGGATGACCCTGACCCCAGGCTCTTCGACCACCCGGAAAGCCCCACCCCCAACCCCACGGAGCCCCTCTTCCTGGCCCAGGCTGAAGTTTACAAGGAGCTGCGTCTGCGTGGCTACGACTACGGCCCTCATTTCCAGGGCATCCTGGAGGCCAGCCTGGAAGGTGACTCGGGGAGGCTGCTGTGGAAGGATAACTGGGTGAGCTTCATGGACACCATGCTGCAGATGTCCATCCTGGGCTCGGCCAAGCACGGCCTGTACCTGCCCACCCGTGTCACCGCCATCCACATCGACCCTGCCACCCACAGGCAGAAGCTGTACACACTGCAGGACAAGGCCCAAGTGGCTGACGTGGTGGTGAGCAGGTGGCTGAGGGTCACAGTGGCCGGAGGCGTCCACATCTCCGGGCTCCACACTGAGTCGGCCCCGCGGCGGCAGCAGGAGCAGCAGGTGCCCATCCTGGAGAAGTTTTGCTTCACTCCCCACACGGAGGAGGGGTGCCTGTCTGAGCGCGCTGCCCTGCAGGAGGAGCTGCAACTGTGCAAGGGGCTGGTGCAGGCACTGCAGACCAAGGTGACCCAGCAGGGGCTGAAGATGGTGGTGCCCGGACTGGATGGGGCCCAGATCCCCCGGGACCCCTCACAGCAGGAACTGCCCCGGCTGTTGTCGGCTGCCTGCAGGCTTCAGCTCAACGGGAACCTGCAGCTGGAGCTGGCGCAGGTGCTGGCCCAGGAGAGGCCCAAGCTGCCAGAGGACCCTCTGCTCAGCGGCCTCCTGGACTCCCCGGCACTCAAGGCCTGCCTGGACACTGCCGTGGAGAACATGCCCAGCCTGAAGATGAAGGTGGTGGAGGTGCTGGCTGGCCACGGTCACCTGTATTCCCGCATCCCAGGCCTGCTCAGCCCCCATCCCCTGCTGCAGCTGAGCTACACGGCCACCGACCGCCACCCCCAGGCCCTGGAGGCTGCCCAGGCCGAGCTGCAGCAGCACGACGTTGCCCAGGGCCAGTGGGATCCCGCAGACCCTGCCCCCAGCGCCCTGGGCAGCGCCGACCTCCTGGTGTGCAACTGTGCTGTGGCTGCCCTCGGGGACCCGGCCTCAGCTCTCAGCAACATGGTGGCTGCCCTGAGAGAAGGGGGCTTTCTGCTCCTGCACACACTGCTCCGGGGGCACCCCCTCGGGGACATCGTGGCCTTCCTCACCTCCACTGAGCCGCAGTATGGCCAGGGCATCCTGAGCCAGGACGCGTGGGAGAGCCTCTTCTCCAGGGTGTCGCTGCGCCTGGTGGGCCTGAAGAAGTCCTTCTACGGCTCCACGCTCTTCCTGTGCCGCCGGCCCACCCCGCAGGACAGCCCCATCTTCCTGCCGGTGGACGATACCAGCTTCCGCTGGGTGGAGTCTCTGAAGGGCATCCTGGCTGACGAAGACTCTTCCCGGCCTGTGTGGCTGAAGGCCATCAACTGTGCCACCTCGGGCGTGGTGGGCTTGGTGAACTGTCTCCGCCGAGAGCCCGGCGGGAACCGCCTCCGGTGTGTGCTGCTCTCCAACCTCAGCAGCACCTCCCACGTCCCGGAGGTGGACCCGGGCTCCGCAGAACTGCAGAAGGTGTTGCAGGGAGACCTGGTGATGAACGTCTACCGCGACGGGGCCTGGGGGGCTTTCCGCCACTTCCTGCTGGAGGAGGACAAGCCTGAGGAGCCGACGGCACATGCCTTTGTGAGCACCCTCACCCGGGGGGACCTGTCCTCCATCCGCTGGGTCTGCTCCTCGCTGCGCCATGCCCAGCCCACCTGCCCTGGCGCCCAGCTCTGCACGGTCTACTACGCCTCCCTCAACTTCCGCGACATCATGCTGGCCACTGGCAAGCTGTCCCCTGATGCCATCCCAGGGAAGTGGACCTCCCAGGACAGCCTGCTAGGTATGGAGTTCTCGGGCCGAGACGCCAGCGGCAAGCGTGTGATGGGACTGGTGCCTGCCAAGGGCCTGGCCACCTCTGTCCTGCTGTCACCGGACTTCCTCTGGGATGTGCCTTCCAACTGGACGCTGGAGGAGGCGGCCTCGGTGCCTGTCGTCTACAGCACGGCCTACTACGCGCTGGTGGTGCGTGGGCGGGTGCGCCCCGGGGAGACGCTGCTCATCCACTCGGGCTCGGGCGGCGTGGGCCAGGCCGCCATCGCCATCGCCCTCAGTCTGGGCTGCCGCGTCTTCACCACCGTGGGGTCGGCTGAGAAGCGGGCGTACCTCCAGGCCAGGTTCCCCCAGCTCGACAGCACCAGCTTCGCCAACTCCCGGGACACATCCTTCGAGCAGCATGTGCTGTGGCACACGGGCGGGAAGGGCGTTGACCTGGTCTTGAACTCCTTGGCGGAAGAGAAGCTGCAGGCCAGCGTGAGGTGCTTGGCTACGCACGGTCGCTTCCTGGAAATTGGCAAATTCGACCTTTCTCAGAACCACCCGCTCGGCATGGCTATCTTCCTGAAGAACGTGACATTCCACGGGGTCCTACTGGATGCGTTCTTCAACGAGAGCAGTGCTGACTGGCGGGAGGTGTGGGCGCTTGTGCAGGCCGGCATCCGGGATGGGGTGGTACGGCCCCTCAAGTGCACGGTGTTCCATGGGGCCCAGGTGGAGGACGCCTTCCGCTACATGGCCCAAGGGAAGCACATTGGCAAAGTCGTCGTGCAGGTGCTTGCGGAGGAGCCGGAGGCAGTGCTGAAGGGGGCCAAACCCAAGCTGATGTCGGCCATCTCCAAGACCTTCTGCCCGGCCCACAAGAGCTACATCATCGCTGGTGGTCTGGGTGGCTTCGGCCTGGAGTTGGCGCAGTGGCTGATACAGCGTGGGGTGCAGAAGCTCGTGTTGACTTCTCGCTCCGGGATCCGGACAGGCTACCAGGCCAAGCAGGTCCGCCGGTGGAGGCGCCAGGGCGTACAGGTGCAGGTGTCCACCAGCAACATCAGCTCACTGGAGGGGGCCCGGGGCCTCATTGCCGAGGCGGCGCAGCTTGGGCCCGTGGGCGGCGTCTTCAACCTGGCCGTGGTCTTGAGAGATGGCTTGCTGGAGAACCAGACCCCAGAGTTCTTCCAGGACGTCTGCAAGCCCAAGTACAGCGGCACCCTGAACCTGGACAGGGTGACCCGAGAGGCGTGCCCTGAGCTGGACTACTTTGTGGTCTTCTCCTCTGTGAGCTGCGGGCGTGGCAATGCGGGACAGAGCAACTACGGCTTTGCCAATTCCGCCATGGAGCGTATCTGTGAGAAACGCCGGCACGAAGGCCTCCCAGGCCTGGCCGTGCAGTGGGGCGCCATCGGCGACGTGGGCATTTTGGTGGAGACGATGAGCACCAACGACACGATCGTCAGTGGCACGCTGCCCCAGCGCATGGCGTCCTGCCTGGAGGTGCTGGACCTCTTCCTGAACCAGCCCCACATGGTCCTGAGCAGCTTTGTGCTGGCTGAGAAGGCTGCGGCCTATAGGGACAGGGACAGCCAGCGGGACCTGGTGGAGGCCGTGGCACACATCCTGGGCATCCGCGACTTGGCTGCTGTCAACCTGGACAGCTCACTGGCGGACCTGGGCCTGGACTCGCTCATGAGCGTGGAGGTGCGCCAGACGCTGGAGCGTGAGCTCAACCTGGTGCTGTCCGTGCGCGAGGTGCGGCAACTCACGCTCCGGAAACTGCAGGAGCTGTCCTCAAAGGCGGATGAGGCCAGCGAGCTGGCATGCCCCACGCCCAAGGAGGATGGTCTGGCCCAGCAGCAGACTCAGCTGAACCTGCGCTCCCTGCTGGTGAACCCGGAGGGCCCCACCCTGATGCGGCTCAACTCCGTGCAGAGCTCGGAGCGGCCCCTGTTCCTGGTGCACCCAATCGAGGGCTCCACCACCGTGTTCCACAGCCTGGCCTCCCGGCTCAGCATCCCCACCTATGGCCTGCAGTGCACCCGAGCTGCGCCCCTTGACAGCATCCACAGCCTGGCTGCCTACTACATCGACTGCATCAGGCAGGTGCAGCCCGAGGGCCCCTACCGCGTGGCCGGCTACTCCTACGGGGCCTGCGTGGCCTTTGAAATGTGCTCCCAGCTGCAGGCCCAGCAGAGCCCAGCCCCCACCCACAACAGCCTCTTCCTGTTCGACGGCTCGCCCACCTACGTACTGGCCTACACCCAGAGCTACCGGGCAAAGCTGACCCCAGGCTGTGAGGCTGAGGCTGAGACGGAGGCCATATGCTTCTTCGTGCAGCAGTTCACGGACATGGAGCACAACAGGGTGCTGGAGGCGCTGCTGCCGCTGAAGGGCCTAGAGGAGCGTGTGGCAGCCGCCGTGGACCTGATCATCAAGAGCCACCAGGGCCTGGACCGCCAGGAGCTGAGCTTTGCGGCCCGGTCCTTCTACTACAAGCTGCGTGCCGCTGAGCAGTACACACCCAAGGCCAAGTACCATGGCAACGTGATGCTACTGCGCGCCAAGACGGGTGGCGCCTACGGCGAGGACCTGGGCGCGGACTACAACCTCTCCCAGGTATGCGACGGGAAAGTATCCGTCCACGTCATCGAGGGTGACCACCGCACGCTGCTGGAGGGCAGCGGCCTGGAGTCCATCATCAGCATCATCCACAGCTCCCTGGCTGAGCCACGCGTGAGCGTGCGGGAGGGCTAGGCCCGTGCCCCCGCCTGCCACCGGAGGTCACTCCACCATCCCCACCCCACCCCACCCCACC