Transcript asmbl_64761

Sequence
Transcript Sequence for observation asmbl_64761 of TGE0000936:
AAAAGTTCTTGTCGGGAGCCAATGAGAGGCTAAGAAAGACAGCGAGCGCGAGGTCCTCGGCCAATCCCGAACGAAGGCCAGGGAGCACTCAGGAGCGTTTCCGAATCCGGGGCCAGGCCTGGTGTGAGTGTCCAATCCGAGAGCGGCAAAGACGAGCCTCGAAGTCCGCCGGCCAATCGAAGGCGGGCCCCAGCGGCGCGTGCGCGCCGCGGCCAGCGCGCGCGGGCGGGGGGGCAGGCGCGCCCCGGACCCAGGATTTATAAAGGCGAGGCCGGGACCGGCGCGCGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTGTCCGACATGCTGCGCCGCGCTCTGCTGTGCCTGGCCGTGGCCGCCCTGGTGCGCGCCGACGCCCCCGAGGAGGAGGACCACGTCCTGGTGCTGCGGAAAAGCAACTTCGCGGAGGCGCTGGCGGCCCACAAGTACCTGCTGGTGGAGTTCTATGCCCCTTGGTGTGGCCACTGCAAGGCTCTGGCCCCTGAGTATGCCAAAGCCGCTGGGAAGCTGAAGGCAGAAGGTTCCGAGATCAGGTTGGCCAAGGTGGACGCCACGGAGGAGTCTGACCTGGCCCAGCAGTACGGCGTGCGCGGCTATCCCACCATCAAGTTCTTCAGGAATGGAGACACGGCTTCCCCCAAGGAATATACAGCTGGCAGAGAGGCTGATGACATCGTGAACTGGCTGAAGAAGCGCACGGGCCCGGCTGCCACCACCCTGCCTGACGGCGCAGCTGCAGAGTCCTTGGTGGAGTCCAGCGAGGTGGCTGTCATCGGCTTCTTCAAGGACGTGGAGTCGGACTCTGCCAAGCAGTTTTTGCAGGCAGCAGAGGCCATCGATGACATACCATTTGGGATCACTTCCAACAGTGACGTGTTCTCCAAATACCAGCTCGACAAAGATGGGGTTGTCCTCTTTAAGAAGTTTGATGAAGGCCGGAACAACTTTGAAGGGGAGGTCACCAAGGAGAACCTGCTGGACTTTATCAAACACAACCAGCTGCCCCTTGTCATCGAGTTCACCGAGCAGACAGCCCCGAAGATTTTTGGAGGTGAAATCAAGACTCACATCCTGCTGTTCTTGCCCAAGAGTGTGTCTGACTATGACGGCAAACTGAGCAACTTCAAAACAGCAGCCGAGAGCTTCAAGGGCAAGATCCTGTTCATCTTCATCGACAGCGACCACACCGACAACCAGCGCATCCTCGAGTTCTTTGGCCTGAAGAAGGAAGAGTGCCCGGCCGTGCGCCTCATCACCCTGGAGGAGGAGATGACCAAGTACAAGCCCGAATCGGAGGAGCTGACGGCAGAGAGGATCACAGAGTTCTGCCACCGCTTCCTGGAGGGCAAAATCAAGCCCCACCTGATGAGCCAGGAGCTGCCGGAGGACTGGGACAAGCAGCCTGTCAAGGTGCTTGTTGGGAAGAACTTTGAAGACGTGGCTTTTGATGAGAAAAAAAACGTCTTTGTGGAGTTCTATGCCCCATGGTGTGGTCACTGCAAACAGTTGGCTCCCATTTGGGATAAACTGGGAGAGACGTACAAGGACCATGAGAACATCGTCATCGCCAAGATGGACTCGACTGCCAACGAGGTGGAGGCCGTCAAAGTGCACAGCTTCCCCACACTCAAGTTCTTTCCTGCCAGTGCCGACAGGACGGTCATTGATTACAACGGGGAACGCACGCTGGATGGTTTTAAGAAATTCCTGGAGAGCGGTGGCCAGGATGGGGCAGGGGATGATGACGATCTCGAGGACCTGGAAGAAGCAGAGGAGCCAGACATGGAGGAAGACGATGATCAGAAAGCTGTGAAAGATGAACTGTAATACGCAAAGCCAGACCCGGGCGCTGCCGAGACCCCTCGGGGGCTGCACACCCAGCAGCAGCGCACGCCTCCGAAGCCTGCGGCCTCGCTTGAAGGAGGGCGTCGCCGGAAACCCAGGGAACCTCTCTGAAGTGACACCTCACCCCTACACACCGTCCGTTCACCCCCGTCTCTTCCTTCTGCTTTTCGGTTTTTGGAAAGGGATCCATCTCCAGGCAGCCCACCCTGGTGGGGCTTGTTTCCTGAAACCATGATGTACTTTTTCATACATGAGTCTGTCCAGAGTGCTTGCTACCGTGTTCGGAGTCTCGCTGCCTCCCTCCCGCGGGAGGTTTCTCCTCTTTTTGAAAATTCCGTCTGTGGGATTTTTAGACATTTTTCGACATCAGGGTATTTGTTCCACCTTGGCCAGGCCTCCTCGGAGAAGCTTGTCCCCCGTGTGGGAGGGACGGAGCCGGACTGGACATGGTCACTCAGTACCGCCTGCAGTGTCGCCATGACTGATCATGGCTCTTGCATTTTTGGGTAAATGGAGACTTCCGGATCCTGTCAGGGTGTCCCCCATGCCTGGAAGAGGAGCTGGTGGCTGCCAGCCCTGGGGCCCGGCACAGGCCTGGGCCTTCCCCTTCCCTCAAGCCAGGGCTCCTCCTCCTGTCGTGGGCTCATTGTGACCACTGGCCTCTCTACAGCACGGCCTGTGGCCTGTTCAAGGCAGAACCACGACCCTTGACTCCCGGGTGGGGAGGTGGCCAAGGATGCTGGAGCTGAATCAGACGCTGACAGTTCTTCAGGCATTTCTATTTCACAATCGAATTGAACACATTGGCCAAATAAAGTTGAAATTTTACCA