Transcript asmbl_64738

Sequence
Transcript Sequence for observation asmbl_64738 of TGE0056073:
AGATGACTCAGGTGAGGCTCGGCCGACGCCCGTGCTCCTCCCGTCCTTTCCCCAGTCATTTTCTGCCCGGCTTGATTTCTGACATTTAAGTGTTTCTTTCGCTGTTCCAGGCTCTGTTCCTCTCCCGGCATTTCCTCCCTGAAGCCTCCAGGTTTCTCATTTGGTTTCTGCCTGCGTTCTTTTCTTTTCTCCACACATCACACTGGCATGCAGCATGTTGTGGCGTGTGAGCATGGGGTGGCCGTGGGTCTCTGTCCCTGACTAAGCCGCCCCTTGTCCCTTCTCAGATTATGTTTGAGACCTTCAACACCCCGGCCATGTACGTGGCCATCCAGGCCGTGCTGTCCCTCTACGCCTCTGGGCGCACCACTGGCATTGTCATGGACTCTGGAGACGGGGTCACCCACACGGTGCCCATCTACGAGGGCTACGCCCTCCCCCACGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACCGACTACCTCATGAAGATCCTCACTGAGCGAGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGCGACATCAAGGAGAAGCTGTGCTACGTCGCCCTGGACTTCGAGCAGGAGATGGCCACCGCCGCATCCTCCTCTTCTCTGGAGAAGAGCTACGAGCTGCCCGATGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGGTGTCCGGAGGCGCTGTTCCAGCCTTCCTTCCTGGGTATGGAATCTTGCGGCATCCACGAGACCACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACGGTGCTGTCGGGCGGCACCACCATGTACCCGGGCATTGCCGACAGGATGCAGAAGGAGATCACCGCCCTGGCGCCCAGCACCATGAAGATCAAGATCATCGCACCCCCAGAGCGCAAGTACTCGGTGTGGATCGGTGGCTCCATCCTGGCCTCACTGTCCACCTTCCAGCAGATGTGGATTAGCAAGCAGGAGTACGACGAGTCGGGCCCCTCCATCGTCCACCGCAAATGCTTCTAAACGGACT