Transcript asmbl_64429

Sequence
Transcript Sequence for observation asmbl_64429 of TGE0029879:
GAGGCGGTCCAGACTATAAAAGCGGCTGCCGGAAAGCGGCCGGCACCTCATTCATTTCTACCGGTCTCTAGTAGTGCAGCTTCGGCTGGTGTCATCGGTGTCCTTCCTCCGCTGCCGCCCCCGCAAGGCTTCGCCGTCATCGAGGCCATTTCCAGCGACTTGTCGCACGCTTTTCTATATACTTCGTTCCCCGCCAACCGCAACCATTGACGCCATGTCGGGTTATTCGAGTGACCGAGACCGCGGCCGGGACCGAGGGTTTGGTGCACCTCGATTTGGAGGAAGTAGGGCAGGGCCCTTATCTGGAAAGAAGTTTGGAAACCCTGGGGAGAAATTAGTTAAAAAGAAGTGGAATCTTGATGAGCTGCCTAAATTTGAGAAGAATTTTTATCAAGAGCACCCTGATTTGGCTAGGCGCACAGCACAAGAGGTGGAAACATACAGAAGAAGCAAGGAAATTACAGTTAGAGGTCACAACTGCCCGAAGCCAGTTCTAAATTTTTATGAAGCCAATTTCCCTGCAAATGTCATGGATGTTATTGCAAGACAGAATTTCACTGAACCCACTGCTATTCAAGCTCAGGGATGGCCAGTTGCTCTAAGTGGATTGGATATGGTTGGAGTGGCACAGACTGGATCTGGGAAAACATTGTCTTATTTGCTTCCTGCCATTGTCCACATCAATCATCAGCCATTCCTAGAGAGAGGCGATGGGCCTATTTGTTTGGTGCTGGCACCAACTCGGGAACTGGCCCAACAGGTGCAGCAAGTAGCTGCTGAATATTGTAGAGCATGTCGCTTGAAGTCTACTTGTATCTACGGTGGTGCTCCTAAGGGACCACAAATACGTGATTTGGAGAGAGGTGTGGAAATCTGTATTGCAACACCTGGAAGACTGATTGACTTTTTAGAGTGTGGAAAAACCAATCTGAGAAGAACAACCTACCTTGTCCTTGATGAAGCAGATAGAATGCTTGATATGGGCTTTGAACCCCAAATAAGGAAGATTGTGGATCAAATAAGACCTGATAGGCAAACTCTAATGTGGAGTGCGACTTGGCCAAAAGAAGTAAGACAGCTTGCTGAAGATTTCCTGAAAGACTATATTCATATAAACATTGGTGCACTTGAACTGAGTGCAAACCACAACATTCTTCAGATTGTGGATGTGTGTCATGACGTAGAAAAGGATGAAAAACTTATTCGTCTAATGGAAGAGATCATGAGTGAGAAGGAGAATAAAACCATTGTTTTTGTGGAAACCAAAAGAAGATGTGATGAGCTTACCAGAAAAATGAGGAGAGATGGGTGGCCTGCCATGGGTATCCATGGTGACAAGAGTCAACAAGAGCGTGACTGGGTTCTAAATGAATTCAAACATGGAAAAGCTCCTATTCTGATTGCTACAGATGTGGCCTCCAGAGGGCTAGGTTAGTACAAACTCGCATTCATGGCTTGGTTTCCCAGAAGATCTCCATTTAACTTTTTTAAAGAAAGTTTATTGCTTTCTTTAACCTGCATTTTTTCTAAGTTTTTTTTCACATAAAGGTGCTGTCTTTGTGGCAAGGCCTAGGCATGACAATCGGAGGACTCGAGGGGGATGGAGGACTAGTGATCGGCTGGCTGCTTCCAGTCGATTAGAGAGGTGAAAAAGCTGAACGTGTGCCAGTAATCTTCAAAAGGCAGAACATATCACCTCTGCCCCGTAAACTGTTCTCTCCGAGGGAAAAAATGGAAGTTATCCTCACAGTTCACTGCCGTGGTATTTCTTCTGTCCCATGCTTTGCATGACTGCCATGGTACAGCCTTGTTTCAAACTGTTCACTGTGATCTGTGGGTCTTTGAGTTTCAGTGAGTTTGCTGAAATGTCGAAGAAGTAGTTCCAAACTTCAATGTTCAATGAAATTTTTGTTCAAGTTTGAAATGGAGAGAGCAGCTTTAAAAGGTACTAAGCCTTTTACAAATTGGTGAGTACTGGCACATGAGATCTAGAGCAGGAGCAACTTCTCACACATAGTAAGTGGGAAAAGAAAGTGCTTTGAAAGTTCCTCCCTCACCTACACAGTAGTCGTCATGTCGAGACCTGCCAGAGAGAGACACATTCTCAAGTGAATCCTGGCTTCTTGGAAGCGCTTGCCTAGACGAGACACAGTGCATAAAAACAACTTTTGGGGGACAGGTATGTTTTCTTGCAGCTGCGGTTGTAAGGTCTTGGCAAGACAAGCAGTGTGGCCAGAATTTTGAACTTCTGATGAATGTGTAATGCAAAGGACCTTGTACATTTTTTTGTTTCAAGGTCCTCAAAATGAGCACATGAAGAGGTTGCTGTGAAACTTTAAGTGGCCCTACTGCGCAGAAGCATTCAGATGTCACTTGATGATCTGTAAGGGAACTTGCTGATTTGGGAATGTGCTTAGGGAACACACATTCCTTTTGACAGGGTCTGTCACTGGGTGGGTGATGAATTATACAGATGACATGTGCTTTTTTTTCTTTTTTCAACCTCAATGGTATTCCTACAGGAAATGGATAACCATTTTAACTGTATTTTTTGCAGCCCGTACCTTCTTGGGAATACAATTGTCTAACTTTTTATTTTTGGTCTGGCTGTTGTGGTGTGCAAAACTCCGTACATTGCTATTTTGCCACACTGCAACACCTTACAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCTAACTCCTCAGAGGATTATATTCATCGAATTGGAAGAACTGCTCGCAGTACCAAAACAGGCACAGCATACACTTTCTTTACACCTAATAACATAAAGCAAGTGAGCGACCTTATCTCTGTGCTTCGTGAAGCTAATCAAGCAATTAATCCCAAGTTGCTTCAGTTGGTCGAAGACAGAGGTTCAGGTAAGGATGACTGATAGGAAATGTTGGTAGTTACGAGTCACATCGTTGTCTACAAATCCATTTAAATGGTATTGGAGGGTGAGTAAAACCTTGAATGTGAAAACTTAAGCTGAAAAATTGTAAAAACATTTCACGCCTACCATGAATAGATCTGTTTCTTTCTGTCCACAATGATTTGTGTCATAGACATAATTGATCAATTTGCAATTGTTTTCTTGACAGGTCGTTCCAGGGGTAGAGGAGGCATGAAGGATGACCGTCGGGACAGATACTCTGCGGGCAAAAGGGGTGGATTTAATACCTTTAGAGACAGGGAAAATTATGACAGAGGTTACTCTAGCCTGCTTAAAAGAGATTTTGGGGCAAAAACTCAGAATGGTGTTTACAGTGCTGCAAATTACACCAATGGGAGCTTTGGAAGTAATTTTGTGTCTGCTGGTATACAGACCAGTTTTAGGACTGGTAATCCAACAGGGACTTACCAGAATGGTTATGATAGCACTCAGCAATACGGAAGTAATGTTCCAAATATGCACAATGGTATGAACCAACAGGCATATGCATATCCTGCTACTGCAGCTGCACCTATGATTGGTTATCCAATGCCAACAGGATATTCCCAATAAGACTTTAGAAGTATATGTAAATGTCTGTTTTTCATAATTGCTCTTTATATTGTGTGTTATCTGACAAGATAGTTATTTAAGAAACATGGGAATTGCAGAAATGACTGCAGTGCAGCAGTAATTATGGTGCACTTTTTCGCTATTTAAGTTGGATATTTCTCTACATTCCTGAAACAATTTTTAGGTTTTTTTTGTACTAGAAAATGCAGGCAGTGTTTTCACAAAAGTAAATGTACAGTGATTTGAAATACAATAAATGAAGGCAATGCATGGCCTTCCAATAAAAAATATTTGAAGACTGAATTAAGTGGAAATTGTACTTTATTTTATATAATGTCATGTAAAACTTTGCTTAAGATGGTCTGGTTTTTTTTTTGTTTTTGTTTGGTTTTTTTTTTCCATGAAAACAAATGACTGTTCCTTTTTATTTAATTTGGGAGGCAGGGGGAATCAGAAGGCCCTTCTTTATAATGAGCTATTCATATTGCAGGAGTCAGAATGAATTGATACAGGTGAATTTTTAGTTACAGGCTAAATTGCATAAAAGCTTTGTCAGCTTCCAGCATCAGGGGAGTCATTTAATAGCCTTTTTCCTTATTTGCTAGTATGGTTAAATGAGAAAATAGTAAAATAGATACAAAGTCATCTATATAGTGTGAGAACGTGGGTGACTTTTTCAAAGTTTATAATTTAAAAAGCTCCAAATAACTGGCTTTTTCAAGAGACTTATACTCATGCTCTTGGCTATACTGTGAATTACTGAAATGTTGAACAAACCTGTGAAAGACATACATTAGCCCTTTAAGATGGCCAGGAGCTAAGCTTGAGTCTCCTTTACTGAATTTCGTTCTTAGTGCAGGTTACTTGTAGATTCTAGTCTTCACAGGCTCCCTGGGGCTCTTAACTAGTCACACTGGGAGTCATGAATGTCTTTCCAATAATTCAGGGAATTCTAGAGATCCTCAAACTGTAAGGTCTATTCATACTCAACACAAGGAAAAAACCTCATTAAAATTAATGACTAATCAGGAGGCAACGTAACCAAAAGCACAGTGAATGAAAGTTTTCATGGTAGGTTCAACATGGGTTTATTGCTAGAAAGATCCAGGGGATAGCTTTAGGTTTAACTTCGGCTCACCAACGTAACTTTCTAATCATTTATTTCAGTAATAGCTAGAAGTGGGTCTGAATGTTTTCCCAGAGTCTGATACGTGTTTTTTTTTGCCAGAAGAGAGGTCTTCAGGAGACTTCATTTAAATTCTGATTATTAAACTGAGGCTTTAATTGATGTTAATGCCTTATGTCAAATGTAAAGTTAGAATTTGCTAGGGCTGGGATAGGGAGTGATATTTCTAGGACTTAGACATTGAAAACTAATTCAGCCTGTAGTAACCTGGATGGTTTTCAATGGCATGGTTAGTCAAATTCATGGTTTTAAACTTAGAAGCAGCTTTCGGGGGAGAGGGTAGGTTGGAGCATTTATTACATATTTTACTGTTTAATGTCTTAACCGTGGGCCTTTTAATTTGTAAACACTGAAATGATTGTTGGGCTGTGGAAAACATTTACCTATTTACCTTGGAAGTTTTAAAAGACAGTCCACTTTTTAGCATGTGTGTTGTGTCCAGCCTGTGGTCGTCTTAACTAATAAATGTGATTTTTCTCCCC