Transcript asmbl_64428

Sequence
Transcript Sequence for observation asmbl_64428 of TGE0057343:
GAGGCGGTCCAGACTATAAAAGCGGCTGCCGGAAAGCGGCCGGCACCTCATTCATTTCTACCGGTCTCTAGTAGTGCAGCTTCGGCTGGTGTCATCGGTGTCCTTCCTCCGCTGCCGCCCCCGCAAGGCTTCGCCGTCATCGAGGCCATTTCCAGCGACTTGTCGCACGCTTTTCTATATACTTCGTTCCCCGCCAACCGCAACCATTGACGCCATGTCGGGTTATTCGAGTGACCGAGACCGCGGCCGGGACCGAGGGTTTGGTGCACCTCGATTTGGAGGAAGTAGGGCAGGGCCCTTATCTGGAAAGAAGTTTGGAAACCCTGGGGAGAAATTAGTTAAAAAGAAGTGGAATCTTGATGAGCTGCCTAAATTTGAGAAGAATTTTTATCAAGAGCACCCTGATTTGGCTAGGCGCACAGCACAAGAGGTGGAAACATACAGAAGAAGCAAGGAAATTACAGTTAGAGGTCACAACTGCCCGAAGCCAGTTCTAAATTTTTATGAAGCCAATTTCCCTGCAAATGTCATGGATGTTATTGCAAGACAGAATTTCACTGAACCCACTGCTATTCAAGCTCAGGGATGGCCAGTTGCTCTAAGTGGATTGGATATGGTTGGAGTGGCACAGACTGGATCTGGGAAAACATTGTCTTATTTGCTTCCTGCCATTGTCCACATCAATCATCAGCCATTCCTAGAGAGAGGCGATGGGCCTATTTGTTTGGTGCTGGCACCAACTCGGGAACTGGCCCAACAGGTGCAGCAAGTAGCTGCTGAATATTGTAGAGCATGTCGCTTGAAGTCTACTTGTATCTACGGTGGTGCTCCTAAGGGACCACAAATACGTGATTTGGAGAGAGGTGTGGAAATCTGTATTGCAACACCTGGAAGACTGATTGACTTTTTAGAGTGTGGAAAAACCAATCTGAGAAGAACAACCTACCTTGTCCTTGATGAAGCAGATAGAATGCTTGATATGGGCTTTGAACCCCAAATAAGGAAGATTGTGGATCAAATAAGACCTGATAGGCAAACTCTAATGTGGAGTGCGACTTGGCCAAAAGAAGTAAGACAGCTTGCTGAAGATTTCCTGAAAGACTATATTCATATAAACATTGGTGCACTTGAACTGAGTGCAAACCACAACATTCTTCAGATTGTGGATGTGTGTCATGACGTAGAAAAGGATGAAAAACTTATTCGTCTAATGGAAGAGATCATGAGTGAGAAGGAGAATAAAACCATTGTTTTTGTGGAAACCAAAAGAAGATGTGATGAGCTTACCAGAAAAATGAGGAGAGATGGGTGGCCTGCCATGGGTATCCATGGTGACAAGAGTCAACAAGAGCGTGACTGGGTTCTAAATGAATTCAAACATGGAAAAGCTCCTATTCTGATTGCTACAGATGTGGCCTCCAGAGGGCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCTAACTCCTCAGAGGATTATATTCATCGAATTGGAAGAACTGCTCGCAGTACCAAAACAGGCACAGCATACACTTTCTTTACACCTAATAACATAAAGCAAGTGAGCGACCTTATCTCTGTGCTTCGTGAAGCTAATCAAGCAATTAATCCCAAGTTGCTTCAGTTGGTCGAAGACAGAGGTTCAGGTCGTTCCAGGGGTAGAGGAGGCATGAAGGATGACCGTCGGGACAGATACTCTGCGGGCAAAAGGGGTGGATTTAATACCTTTAGAGACAGGGAAAATTATGACAGAGGTTACTCTAGCCTGCTTAAAAGAGATTTTGGGGCAAAAACTCAGAATGGTGTTTACAGTGCTGCAAATTACACCAATGGGAGCTTTGGAAGTAATTTTGTGTCTGCTGGTATACAGACCAGTTTTAGGACTGGTAATCCAACAGGGACTTACCAGAATGGTTATGATAGCACTCAGCAATACGGAAGTAATGTTCCAAATATGCACAATGGTATGAACCAACAGGCATATGCATATCCTGCTACTGCAGCTGCACCTATGATTGGTTATCCAATGCCAACAGGATATTCCCAATAAGACTTTAGAAGTATATGTAAATGTCTGTTTTTCATAATTGCTCTTTATATTGTGTGTTATCTGACAAGATAGTTATTTAAGAAACATGGGAATTGCAGAAATGACTGCAGTGCAGCAGTAATTATGGTGCACTTTTTCGCTATTTAAGTTGGATATTTCTCTACATTCCTGAAACAATTTTTAGGTTTTTTTTGTACTAGAAAATGCAGGCAGTGTTTTCACAAAAGTAAATGTACAGTGATTTGAAATACAATAAATGAAGGCAATGCATGGCCTTCCAATAAAAAATATTTGAAGACTGAATTAAGTGGAAATTGTACTTTATTTTATATAATGTCATGTAAAACTTTGCTTAAGATGGTCTGGTTTTTTTTTTGTTTTTGTTTGGTTTTTTTTTTCCATGAAAACAAATGACTGTTCCTTTTTATTTAATTTGGGAGGCAGGGGGAATCAGAAGGCCCTTCTTTATAATGAGCTATTCATATTGCAGGAGTCAGAATGAATTGATACAGGTGAATTTTTAGTTACAGGCTAAATTGCATAAAAGCTTTGTCAGCTTCCAGCATCAGGGGAGTCATTTAATAGCCTTTTTCCTTATTTGCTAGTATGGTTAAATGAGAAAATAGTAAAATAGATACAAAGTCATCTATATAGTGTGAGAACGTGGGTGACTTTTTCAAAGTTTATAATTTAAAAAGCTCCAAATAACTGGCTTTTTCAAGAGACTTATACTCATGCTCTTGGCTATACTGTGAATTACTGAAATGTTGAACAAACCTGTGAAAGACATACATTAGCCCTTTAAGATGGCCAGGAGCTAAGCTTGAGTCTCCTTTACTGAATTTCGTTCTTAGTGCAGGTTACTTGTAGATTCTAGTCTTCACAGGCTCCCTGGGGCTCTTAACTAGTCACACTGGGAGTCATGAATGTCTTTCCAATAATTCAGGGAATTCTAGAGATCCTCAAACTGTAAGGTCTATTCATACTCAACACAAGGAAAAAACCTCATTAAAATTAATGACTAATCAGGAGGCAACGTAACCAAAAGCACAGTGAATGAAAGTTTTCATGGTAGGTTCAACATGGGTTTATTGCTAGAAAGATCCAGGGGATAGCTTTAGGTTTAACTTCGGCTCACCAACGTAACTTTCTAATCATTTATTTCAGTAATAGCTAGAAGTGGGTCTGAATGTTTTCCCAGAGTCTGATACGTGTTTTTTTTTGCCAGAAGAGAGGTCTTCAGGAGACTTCATTTAAATTCTGATTATTAAACTGAGGCTTTAATTGATGTTAATGCCTTATGTCAAATGTAAAGTTAGAATTTGCTAGGGCTGGGATAGGGAGTGATATTTCTAGGACTTAGACATTGAAAACTAATTCAGCCTGTAGTAACCTGGATGGTTTTCAATGGCATGGTTAGTCAAATTCATGGTTTTAAACTTAGAAGCAGCTTTCGGGGGAGAGGGTAGGTTGGAGCATTTATTACATATTTTACTGTTTAATGTCTTAACCGTGGGCCTTTTAATTTGTAAACACTGAAATGATTGTTGGGCTGTGGAAAACATTTACCTATTTACCTTGGAAGTTTTAAAAGACAGTCCACTTTTTAGCATGTGTGTTGTGTCCAGCCTGTGGTCGTCTTAACTAATAAATGTGATTTTTCTCCCC