Transcript asmbl_64426

Sequence
Transcript Sequence for observation asmbl_64426 of TGE0059658:
CTGCGTTATATAATTTTGATTCGTTGATCCGGAGCTCTACCGCGGCGTTCCCCCAGCTGGGTTTGCTAGCAGAAGTGTTTCTGAGAAAACCCTTGTTCTGTTATCGCTGACTGTACTGTTTAGGTTCTTACCACTAAAGCTGTTTGGTTCCAAAACGGCCATATGAGTAACATCGTCGTGATGCTCTTCGGTTCATGTAGCCTTGTTATTGCTGATAGTGAATTGCTAGGCTGGTGGGGAAGATTACAGTAACCACAAGAAGTGGTGTGTGCCAGAATCCCAAATTCTGGCATGTGGGTGACAAGTTTCCGACATGATAAATCCCCGGCTTCCGACATGATAAATCCCAGGCTGTTTACATGACCTAAGTAATGTGTACTTGGGACTACGGGAAATGTTAACTGTGGCTGTTGAGAGAGAGAGAGATTTTCACGAAGGACAGTGCTAGGTTTACCTCTCGAAGTCTGTTTTCAGTGGTTTTTAGCTTGTGCCAATGGATGACAAATCTATACAGAAACCTGGGTATAGCCATTTGAAAATGTGAATAACGTTTTTTTTCATTCCAGGTTTGGTGCACCTCGATTTGGAGGAAGTAGGGCAGGGCCCTTATCTGGAAAGAAGTTTGGAAACCCTGGGGAGAAATTAGTTAAAAAGAAGTGGAATCTTGATGAGCTGCCTAAATTTGAGAAGAATTTTTATCAAGAGCACCCTGATTTGGCTAGGCGCACAGCACAAGAGGTGGAAACATACAGAAGAAGCAAGGAAATTACAGTTAGAGGTCACAACTGCCCGAAGCCAGTTCTAAATTTTTATGAAGCCAATTTCCCTGCAAATGTCATGGATGTTATTGCAAGACAGAATTTCACTGAACCCACTGCTATTCAAGCTCAGGGATGGCCAGTTGCTCTAAGTGGATTGGATATGGTTGGAGTGGCACAGACTGGATCTGGGAAAACATTGTCTTATTTGCTTCCTGCCATTGTCCACATCAATCATCAGCCATTCCTAGAGAGAGGCGATGGGCCTATTTGTTTGGTGCTGGCACCAACTCGGGAACTGGCCCAACAGGTGCAGCAAGTAGCTGCTGAATATTGTAGAGCATGTCGCTTGAAGTCTACTTGTATCTACGGTGGTGCTCCTAAGGGACCACAAATACGTGATTTGGAGAGAGGTGTGGAAATCTGTATTGCAACACCTGGAAGACTGATTGACTTTTTAGAGTGTGGAAAAACCAATCTGAGAAGAACAACCTACCTTGTCCTTGATGAAGCAGATAGAATGCTTGATATGGGCTTTGAACCCCAAATAAGGAAGATTGTGGATCAAATAAGACCTGATAGGCAAACTCTAATGTGGAGTGCGACTTGGCCAAAAGAAGTAAGACAGCTTGCTGAAGATTTCCTGAAAGACTATATTCATATAAACATTGGTGCACTTGAACTGAGTGCAAACCACAACATTCTTCAGATTGTGGATGTGTGTCATGACGTAGAAAAGGATGAAAAACTTATTCGTCTAATGGAAGAGATCATGAGTGAGAAGGAGAATAAAACCATTGTTTTTGTGGAAACCAAAAGAAGATGTGATGAGCTTACCAGAAAAATGAGGAGAGATGGGTGGCCTGCCATGGGTATCCATGGTGACAAGAGTCAACAAGAGCGTGACTGGGTTCTAAATGAATTCAAACATGGAAAAGCTCCTATTCTGATTGCTACAGATGTGGCCTCCAGAGGGCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCTAACTCCTCAGAGGATTATATTCATCGAATTGGAAGAACTGCTCGCAGTACCAAAACAGGCACAGCATACACTTTCTTTACACCTAATAACATAAAGCAAGTGAGCGACCTTATCTCTGTGCTTCGTGAAGCTAATCAAGCAATTAATCCCAAGTTGCTTCAGTTGGTCGAAGACAGAGGTTCAGGTCGTTCCAGGGGTAGAGGAGGCATGAAGGATGACCGTCGGGACAGATACTCTGCGGGCAAAAGGGGTGGATTTAATACCTTTAGAGACAGGGAAAATTATGACAGAGGTTACTCTAGCCTGCTTAAAAGAGATTTTGGGGCAAAAACTCAGAATGGTGTTTACAGTGCTGCAAATTACACCAATGGGAGCTTTGGAAGTAATTTTGTGTCTGCTGGTATACAGACCAGTTTTAGGACTGGTAATCCAACAGGGACTTACCAGAATGGTTATGATAGCACTCAGCAATACGGAAGTAATGTTCCAAATATGCACAATGGTATGAACCAACAGGCATATGCATATCCTGCTACTGCAGCTGCACCTATGATTGGTTATCCAATGCCAACAGGATATTCCCAATAAGACTTTAGAAGTATATGTAAATGTCTGTTTTTCATAATTGCTCTTTATATTGTGTGTTATCTGACAAGATAGTTATTTAAGAAACATGGGAATTGCAGAAATGACTGCAGTGCAGCAGTAATTATGGTGCACTTTTTCGCTATTTAAGTTGGATATTTCTCTACATTCCTGAAACAATTTTTAGGTTTTTTTTGTACTAGAAAATGCAGGCAGTGTTTTCACAAAAGTAAATGTACAGTGATTTGAAATACAATAAATGAAGGCAATGCATGGCCTTCCAATAAAAAATATTTGAAGACTGAATTAAGTGGAAATTGTACTTTATTTTATATAATGTCATGTAAAACTTTGCTTAAGATGGTCTGGTTTTTTTTTTGTTTTTGTTTGGTTTTTTTTTTCCATGAAAACAAATGACTGTTCCTTTTTATTTAATTTGGGAGGCAGGGGGAATCAGAAGGCCCTTCTTTATAATGAGCTATTCATATTGCAGGAGTCAGAATGAATTGATACAGGTGAATTTTTAGTTACAGGCTAAATTGCATAAAAGCTTTGTCAGCTTCCAGCATCAGGGGAGTCATTTAATAGCCTTTTTCCTTATTTGCTAGTATGGTTAAATGAGAAAATAGTAAAATAGATACAAAGTCATCTATATAGTGTGAGAACGTGGGTGACTTTTTCAAAGTTTATAATTTAAAAAGCTCCAAATAACTGGCTTTTTCAAGAGACTTATACTCATGCTCTTGGCTATACTGTGAATTACTGAAATGTTGAACAAACCTGTGAAAGACATACATTAGCCCTTTAAGATGGCCAGGAGCTAAGCTTGAGTCTCCTTTACTGAATTTCGTTCTTAGTGCAGGTTACTTGTAGATTCTAGTCTTCACAGGCTCCCTGGGGCTCTTAACTAGTCACACTGGGAGTCATGAATGTCTTTCCAATAATTCAGGGAATTCTAGAGATCCTCAAACTGTAAGGTCTATTCATACTCAACACAAGGAAAAAACCTCATTAAAATTAATGACTAATCAGGAGGCAACGTAACCAAAAGCACAGTGAATGAAAGTTTTCATGGTAGGTTCAACATGGGTTTATTGCTAGAAAGATCCAGGGGATAGCTTTAGGTTTAACTTCGGCTCACCAACGTAACTTTCTAATCATTTATTTCAGTAATAGCTAGAAGTGGGTCTGAATGTTTTCCCAGAGTCTGATACGTGTTTTTTTTTGCCAGAAGAGAGGTCTTCAGGAGACTTCATTTAAATTCTGATTATTAAACTGAGGCTTTAATTGATGTTAATGCCTTATGTCAAATGTAAAGTTAGAATTTGCTAGGGCTGGGATAGGGAGTGATATTTCTAGGACTTAGACATTGAAAACTAATTCAGCCTGTAGTAACCTGGATGGTTTTCAATGGCATGGTTAGTCAAATTCATGGTTTTAAACTTAGAAGCAGCTTTCGGGGGAGAGGGTAGGTTGGAGCATTTATTACATATTTTACTGTTTAATGTCTTAACCGTGGGCCTTTTAATTTGTAAACACTGAAATGATTGTTGGGCTGTGGAAAACATTTACCTATTTACCTTGGAAGTTTTAAAAGACAGTCCACTTTTTAGCATGTGTGTTGTGTCCAGCCTGTGGTCGTCTTAACTAATAAATGTGATTTTTCTCCCC