Transcript asmbl_64423

Sequence
Transcript Sequence for observation asmbl_64423 of TGE0059657:
CGTTAAAAGAGCTTCTCGCCGCTGATTGGTCATCAGAGGAGCACTTCCTTTCACAGGACGTGAAACGGGGGCGGTTTGGGAAGTTTAGAGACCATTCTCCGCCGACCAAAACCCGTCAAAGGATTATCAGACACGCGGGTCGGACGGTCCACATCAGCCGGCAGCCCGGGCGGGTCCCGGGGTGCGAGCAGCGCACTTCCGTAGTGCAGCTTCGGCTGGTGTCATCGGTGTCCTTCCTCCGCTGCCGCCCCCGCAAGGCTTCGCCGTCATCGAGGCCATTTCCAGCGACTTGTCGCACGCTTTTCTATATACTTCGTTCCCCGCCAACCGCAACCATTGACGCCATGTCGGGTTATTCGAGTGACCGAGACCGCGGCCGGGACCGAGGGTTTGGTGCACCTCGATTTGGAGGAAGTAGGGCAGGGCCCTTATCTGGAAAGAAGTTTGGAAACCCTGGGGAGAAATTAGTTAAAAAGAAGTGGAATCTTGATGAGCTGCCTAAATTTGAGAAGAATTTTTATCAAGAGCACCCTGATTTGGCTAGGCGCACAGCACAAGAGGTGGAAACATACAGAAGAAGCAAGGAAATTACAGTTAGAGGTCACAACTGCCCGAAGCCAGTTCTAAATTTTTATGAAGCCAATTTCCCTGCAAATGTCATGGATGTTATTGCAAGACAGAATTTCACTGAACCCACTGCTATTCAAGCTCAGGGATGGCCAGTTGCTCTAAGTGGATTGGATATGGTTGGAGTGGCACAGACTGGATCTGGGAAAACATTGTCTTATTTGCTTCCTGCCATTGTCCACATCAATCATCAGCCATTCCTAGAGAGAGGCGATGGGCCTATTTGTTTGGTGCTGGCACCAACTCGGGAACTGGCCCAACAGGTGCAGCAAGTAGCTGCTGAATATTGTAGAGCATGTCGCTTGAAGTCTACTTGTATCTACGGTGGTGCTCCTAAGGGACCACAAATACGTGATTTGGAGAGAGGTGTGGAAATCTGTATTGCAACACCTGGAAGACTGATTGACTTTTTAGAGTGTGGAAAAACCAATCTGAGAAGAACAACCTACCTTGTCCTTGATGAAGCAGATAGAATGCTTGATATGGGCTTTGAACCCCAAATAAGGAAGATTGTGGATCAAATAAGACCTGATAGGCAAACTCTAATGTGGAGTGCGACTTGGCCAAAAGAAGTAAGACAGCTTGCTGAAGATTTCCTGAAAGACTATATTCATATAAACATTGGTGCACTTGAACTGAGTGCAAACCACAACATTCTTCAGATTGTGGATGTGTGTCATGACGTAGAAAAGGATGAAAAACTTATTCGTCTAATGGAAGAGATCATGAGTGAGAAGGAGAATAAAACCATTGTTTTTGTGGAAACCAAAAGAAGATGTGATGAGCTTACCAGAAAAATGAGGAGAGATGGGTGGCCTGCCATGGGTATCCATGGTGACAAGAGTCAACAAGAGCGTGACTGGGTTCTAAATGAATTCAAACATGGAAAAGCTCCTATTCTGATTGCTACAGATGTGGCCTCCAGAGGGCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCTAACTCCTCAGAGGATTATATTCATCGAATTGGAAGAACTGCTCGCAGTACCAAAACAGGCACAGCATACACTTTCTTTACACCTAATAACATAAAGCAAGTGAGCGACCTTATCTCTGTGCTTCGTGAAGCTAATCAAGCAATTAATCCCAAGTTGCTTCAGTTGGTCGAAGACAGAGGTTCAGGTCGTTCCAGGGGTAGAGGAGGCATGAAGGATGACCGTCGGGACAGATACTCTGCGGGCAAAAGGGGTGGATTTAATACCTTTAGAGACAGGGAAAATTATGACAGAGGTTACTCTAGCCTGCTTAAAAGAGATTTTGGGGCAAAAACTCAGAATGGTGTTTACAGTGCTGCAAATTACACCAATGGGAGCTTTGGAAGTAATTTTGTGTCTGCTGGTATACAGACCAGTTTTAGGACTGGTAATCCAACAGGGACTTACCAGAATGGTTATGATAGCACTCAGCAATACGGAAGTAATGTTCCAAATATGCACAATGGTATGAACCAACAGGCATATGCATATCCTGCTACTGCAGCTGCACCTATGATTGGTTATCCAATGCCAACAGGATATTCCCAATAAGACTTTAGAAGTATATGTAAATGTCTGTTTTTCATAATTGCTCTTTATATTGTGTGTTATCTGACAAGATAGTTATTTAAGAAACATGGGAATTGCAGAAATGACTGCAGTGCAGCAGTAATTATGGTGCACTTTTTCGCTATTTAAGTTGGATATTTCTCTACATTCCTGAAACAATTTTTAGGTTTTTTTTGTACTAGAAAATGCAGGCAGTGTTTTCACAAAAGTAAATGTACAGTGATTTGAAATACAATAAATGAAGGCAATGCATGGCCTTCCAATAAAAAATATTTGAAGACTGAATTAAGTGGAAATTGTACTTTATTTTATATAATGTCATGTAAAACTTTGCTTAAGATGGTCTGGTTTTTTTTTTGTTTTTGTTTGGTTTTTTTTTTCCATGAAAACAAATGACTGTTCCTTTTTATTTAATTTGGGAGGCAGGGGGAATCAGAAGGCCCTTCTTTATAATGAGCTATTCATATTGCAGGAGTCAGAATGAATTGATACAGGTGAATTTTTAGTTACAGGCTAAATTGCATAAAAGCTTTGTCAGCTTCCAGCATCAGGGGAGTCATTTAATAGCCTTTTTCCTTATTTGCTAGTATGGTTAAATGAGAAAATAGTAAAATAGATACAAAGTCATCTATATAGTGTGAGAACGTGGGTGACTTTTTCAAAGTTTATAATTTAAAAAGCTCCAAATAACTGGCTTTTTCAAGAGACTTATACTCATGCTCTTGGCTATACTGTGAATTACTGAAATGTTGAACAAACCTGTGAAAGACATACATTAGCCCTTTAAGATGGCCAGGAGCTAAGCTTGAGTCTCCTTTACTGAATTTCGTTCTTAGTGCAGGTTACTTGTAGATTCTAGTCTTCACAGGCTCCCTGGGGCTCTTAACTAGTCACACTGGGAGTCATGAATGTCTTTCCAATAATTCAGGGAATTCTAGAGATCCTCAAACTGTAAGGTCTATTCATACTCAACACAAGGAAAAAACCTCATTAAAATTAATGACTAATCAGGAGGCAACGTAACCAAAAGCACAGTGAATGAAAGTTTTCATGGTAGGTTCAACATGGGTTTATTGCTAGAAAGATCCAGGGGATAGCTTTAGGTTTAACTTCGGCTCACCAACGTAACTTTCTAATCATTTATTTCAGTAATAGCTAGAAGTGGGTCTGAATGTTTTCCCAGAGTCTGATACGTGTTTTTTTTTGCCAGAAGAGAGGTCTTCAGGAGACTTCATTTAAATTCTGATTATTAAACTGAGGCTTTAATTGATGTTAATGCCTTATGTCAAATGTAAAGTTAGAATTTGCTAGGGCTGGGATAGGGAGTGATATTTCTAGGACTTAGACATTGAAAACTAATTCAGCCTGTAGTAACCTGGATGGTTTTCAATGGCATGGTTAGTCAAATTCATGGTTTTAAACTTAGAAGCAGCTTTCGGGGGAGAGGGTAGGTTGGAGCATTTATTACATATTTTACTGTTTAATGTCTTAACCGTGGGCCTTTTAATTTGTAAACACTGAAATGATTGTTGGGCTGTGGAAAACATTTACCTATTTACCTTGGAAGTTTTAAAAGACAGTCCACTTTTTAGCATGTGTGTTGTGTCCAGCCTGTGGTCGTCTTAACTAATAAATGTGATTTTTCTCCCC