Transcript asmbl_64255

Sequence
Transcript Sequence for observation asmbl_64255 of TGE0057340:
CGGAAGGTGACGTGGACACGGAAGTGGTCGTCGTCGCGGCACCGGTGGGAGCTAGGCGCGAGGCTCGGAGTGCGGCCAGCGGGCGGAGGCGGTCTCGCATCGGCGGCGACGGAGGGCTCAGGCGTCGTCGTTTGGGTGGGGGGCCGCTGAACTGACAAGCGACATTTCAGCTCCTTTCACCCGCCGGAACCCCGGAGCCGGGGCCCGCTCAGCCGGCGTTACCATGACCAAGGCCGGTAGCAAGGGCGGGAACCTCCGCGACAAGCTGGACGGCAACGAACTGGACCTGAGCCTCAGCGACCTGAATGAGGTCCCGGTGAAGGAGCTGGCTGCCCTTCCAAAGGCCACCATCCTGGATCTGTCTTGTAATAAACTGACTACTCTACCGTCGGATTTCTGTGGCCTCACACACCTGGTGAAGCTAGACCTGAGTAAGAACAAGCTGCAGCAGCTGCCAGCAGACTTTGGCCGTCTGGTCAACCTCCAGCACCTGGATCTCCTCAACAACAAGCTGGTCACCTTGCCTGTCAGCTTTGCTCAGCTCAAGAACCTGAAGTGGTTGGACCTGAAGGATAACCCCCTGGATCCTGTCCTGGCCAAGGTGGCAGGTGACTGCTTGGATGAGAAGCAGTGTAAGCAGTGTGCAAACAAGGTGTTACAGCACATGAAGGCCGTGCAGGCAGATCAGGAGCGGGAGAGGCAGCGGCGGCTGGAAGTAGAACGTGAGGCAGAGAAGAAGCGTGAGGCTAAGCAGCGAGCTAAGGAAGCTCAGGAGCGGGAACTGCGGAAGCGGGAGAAGGCGGAAGAGAAGGAGCGCCGGAGAAAGGAGTATGATGCCCTCAAAGCAGCCAAGCGGGAGCAGGAGAAGAAACCTAAGAAGGAAGCAAATCAGGCCCCGAAATCTAAGTCTGGCTCCCGTCCCCGCAAGCCACCACCCCGGAAGCACACTCGTTCCTGGGCTGTGCTGAAGCTGCTGCTGCTGCTGCTGCTATTTGGTGTGGCGGGAGGGCTGGTTGCTTGTCGGGTGACAGAGCTGCAGCAGCAGCCCCTCTGCACCAGCGTGAACACCATCTATGACAATGCGGTCCAGGGTCTACGCCGCCATGAGATCCTCCAGTGGGTCCTCCAGACCGACTCTCAGCAGTGAGCTTGTCCCCAGCACCTGCTGCCTCCCAGCCTTGGAGTTTGGATTCCTATGGAATTGGGTTCTGCTGGACACAACCTCTTTTTAGCATCAGACCTACCTGCCATCATCAAATGGCTGCAGATTGGTACATGAGACCTCCTCTTTGTAGGACTTCTTCATTCCTTAGTCAGGGTTCCCTGAAGGAATGAGGAGAAATGGGAGG