Transcript asmbl_64002

Sequence
Transcript Sequence for observation asmbl_64002 of TGE0059652:
TGCCCTGGAGGAGGCCAACACTGAGCTGGAGGTGAAGATCCGTGACTGGTACCAGAGGCAGGCCCCGGGGCCCGCCCGTGACTACAGCCAGTACTACAGGACAATTGAGGAGCTGCAGAACAAGATCCTCACAGCCACCGTGGACAATGCCAACATCCTGCTACAGATTGACAATGCCCGTCTGGCTGCTGATGACTTCCGCACCAAGTTTGAGACAGAGCAGGCCCTGCGCCTGAGTGTGGAGGCCGACATCAATGGCCTGCGCAGGGTGCTGGATGAGCTGACCCTGGCCAGAGCCGACCTGGAGATGCAGATTGAGAACCTCAAGGAGGAGCTGGCCTACCTGAAGAAGAACCACGAGGAGGAGATGAACGCCCTGCGAGGCCAGGTGGGTGGTGAGATCAATGTGGAGATGGACGCTGCCCCAGGCGTGGACCTGAGCCGCATCCTCAACGAGATGCGTGACCAGTATGAGAAGATGGCAGAGAAGAACCGCAAGGATGCCGAGGATTGGTTCTTCAGCAAGACAGAGGAACTGAACCGCGAGGTGGCCACCAACAGTGAGCTGGTGCAGAGTGGCAAGAGTGAGATCTCGGAGCTCCGGCGCACCATGCAGGCCTTGGAGATAGAGCTGCAGTCCCAGCTCAGCATGAAAGCATCCCTGGAGGGCAACCTGGCGGAGACAGAGAACCGCTACTGCGTGCAGCTGTCCCAGATCCAGGGGCTGATTGGCAGCGTGGAGGAGCAGCTGGCCCAGCTTCGCTGCGAGATGGAGCAGCAGAACCAGGAATACAAAATCCTGCTGGATGTGAAGACGCGGCTGGAGCAGGAGATTGCCACCTACCGCCGCCTGCTGGAGGGAGAGGATGCCCACCTGACTCAGTACAAGAAAGAACCGGTGACCACCCGTCAGGTGCGTACCATTGTGGAAGAGGTCCAGGATGGCAAGGTCATCTCCTCCCGCGAGCAGGTCCACCAGACCACCCGCTGAGGACTCAGCTACCCCGGCCGGCCACCCAGGAGGCAGGGAGGCAGCCGCCCCATCTGCCCCACAGTCTCCGGCCTCTCCAGCCTCAGCCCCCTGCTTCAGTCCCTTCCCCATGCTTCCTTGCCTGATGACAATAAAGCTTGTTGAC