Transcript asmbl_64001

Sequence
Transcript Sequence for observation asmbl_64001 of TGE0056265:
GCCCATATTTGCTCTCAGGAGCCTGCAAATTCCTCAGGGCTCAGATATCCGCCCCTGACACCATTCCTCCCTTCCCCCCTCCACCGGCCGCGGGCATAAAAGGCGCCAGGTGAGGGCCTCGCCGCTCCTCCCGCGAATCGCAGCTTCTGAGACCAGGGTTGCTCCGTCCGTGCTCCGCCTCGCCATGACTTCCTACAGCTATCGCCAGTCGTCGGCCACGTCGTCCTTCGGAGGCCTGGGCGGCGGCTCCGTGCGTTTTGGGCCGGGGGTCGCCTTTCGCGCGCCCAGCATTCACGGGGGCTCCGGCGGCCGCGGCGTATCCGTGTCCTCCGCCCGCTTTGTGTCCTCGTCCTCCTCGGGGGCCTACGGCGGCGGCTACGGCGGCGTCCTGACCGCGTCCGACGGGCTGCTGGCGGGCAACGAGAAGCTAACCATGCAGAACCTCAACGACCGCCTGGCCTCCTACCTGGACAAGGTGCGCGCCCTGGAGGCGGCCAACGGCGAGCTAGAGGTGAAGATCCGCGACTGGTACCAGAAGCAGGGGCCTGGGCCCTCCCGCGACTACAGCCACTACTACACGACCATCCAGGACCTGCGGGACAAGATTCTTGGTGCCACCATTGAGAACTCCAGGATTGTCCTGCAGATCGACAATGCCCGTCTGGCTGCAGATGACTTCCGAACCAAGTTTGAGACGGAACAGGCTCTGCGCATGAGCGTGGAGGCCGACATCAACGGCCTGCGCAGGGTGCTGGATGAGCTGACCCTGGCCAGGACCGACCTGGAGATGCAGATCGAAGGCCTGAAGGAAGAGCTGGCCTACCTGAAGAAGAACCATGAGGAGGAAATCAGTACGCTGAGGGGCCAAGTGGGAGGCCAGGTCAGTGTGGAGGTGGATTCCGCTCCGGGCACCGATCTCGCCAAGATCCTGAGTGACATGCGAAGCCAATATGAGGTCATGGCCGAGCAGAACCGGAAGGATGCTGAAGCCTGGTTCACCAGCCGGACTGAAGAATTGAACCGGGAGGTCGCTGGCCACACGGAGCAGCTCCAGATGAGCAGGTCCGAGGTTACTGACCTGCGGCGCACCCTTCAGGGTCTTGAGATTGAGCTGCAGTCACAGCTGAGCATGAAAGCTGCCTTGGAAGACACACTGGCAGAAACGGAGGCGCGCTTTGGAGCCCAGCTGGCGCATATCCAGGCGCTGATCAGCGGTATTGAAGCCCAGCTGGGCGATGTGCGAGCTGATAGTGAGCGGCAGAATCAGGAGTACCAGCGGCTCATGGACATCAAGTCGCGGCTGGAGCAGGAGATTGCCACCTACCGCAGCCTGCTCGAGGGACAGGAAGATCACTACAACAATTTGTCTGCCTCCAAGGTCCTCTGAGGCAGCAGGCTCTGGGGCTTCTGCTGTCCTTTGGAGGGTGTCTTCTGGGTAGAGGGATGGGAAGGAAGGGACCCTTACCCCCGGCTCTTCTCCTGACCTGCCAATAAAAATTTATGGTCCAAGGGA