Transcript asmbl_63790

Sequence
Transcript Sequence for observation asmbl_63790 of TGE0059651:
AGCCAGGGCTGCAGCCTCATCTGTTTGCGGATCAGAACCCGAGCTGTGCTTGTGGCTGCGGCTGCTAACTGGCTGCGCACAGGGAGCTGTCACCATGCCTCACTCGTACCCAGCCCTTTCTGCTGAGCAGAAGAAGGAGTTGTCTGACATTGCCCTGCGGATTGTAGCCCCGGGCAAAGGCATTCTGGCTGCGGATGAGTCTGTAGGCAGCATGGCCAAGCGGCTGAGCCAAATTGGGGTGGAAAACACAGAGGAGAACCGCCGGCTGTACCGCCAGGTCCTGTTCAGTGCTGATGACCGTGTGAAAAAGTGCATTGGAGGCGTCATTTTCTTCCATGAGACCCTCTACCAGAAAGATGATAATGGTGTTCCCTTCGTCCGAACCATCCAGGATAAGGGCATCGTCGTGGGCATCAAGGTTGACAAGGGTGTGGTGCCTCTAGCTGGGACTGATGGAGAAACCACCACTCAAGGGCTGGATGGGCTCTCAGAACGCTGTGCCCAATACAAGAAGGATGGTGCTGACTTTGCCAAGTGGCGCTGTGTGCTGAAAATCAGTGAGCGTACACCCTCTGCACTTGCCATTCTGGAGAACGCCAACGTGCTGGCCCGTTATGCCAGTATCTGCCAGCAGAATGGCATTGTGCCTATTGTGGAACCTGAAATATTGCCTGATGGAGACCACGACCTCAAACGTTGTCAGTATGTTACAGAGAAGGTCTTGGCTGCTGTGTACAAGGCCCTGAGTGACCATCATGTATACCTGGAGGGGACCCTGCTCAAGCCCAACATGGTGACCCCGGGCCATGCCTGTCCCATCAAGTATACCCCAGAGGAGATTGCCATGGCAACTGTCACTGCCCTGCGTCGCACTGTGCCCCCAGCTGTCCCAGGAGTGACCTTCCTGTCTGGGGGTCAGAGCGAAGAAGAGGCATCATTCAACCTCAATGCCATCAACCGCTGCCCCCTTCCCCGACCCTGGGCGCTTACCTTCTCCTATGGGCGTGCCCTGCAAGCCTCTGCACTCAATGCCTGGCGAGGGCAACGGGACAATGCTGGGGCTGCCACTGAGGAGTTCATCAAGCGGGCTGAGGTGAATGGGCTTGCAGCCCAGGGCAAGTATGAAGGCAGTGGAGAAGATGGTGGAGCAGCAGCACAGTCACTCTACATTGCCAACCATGCCTACTGAGTATCCACTCCATACCACAGCCCTTGGCCCAGCCATCTGCACCCACTTTTGCTTGTAGTCATGGCCAGGGCCAAATAGCTATGCAGAGCAGAGATGCCTTCACCTGGCACCAACTTGTCTTCCTTTCTCTCTTCCCTTCCCCTCTCTCATTGCTGCACCTGGGACCATAGGATGGGAGGATAGGGAGCCCCTCATGACTGAGGGCAGAAGAAATTGCTAGAAGTCAGAACAGGATGGCTGGGTCTCCCCCTACCTCTTCCAGCTCCCACAATTTTCCCATGATGAGGTAGCTTCTCCCTGGGCTCTCCTTCTTGCCTGCCCTGTCTCCTGGGATCAGAGGGTAGTACAGAAGCCCTGACTCATGCCTTGAGTACATACCATACAGCAAATAAATGGTAGCAAAAC