Transcript asmbl_63782

Sequence
Transcript Sequence for observation asmbl_63782 of TGE0056264:
CTGCCTCTCCCTCCCTTCCTCAGGCATCAGAGCGGAGACTTCAGGGAGACCAGAGCCCAGCTTGCCAGGCACTGAGCTAGAAGCCCTGCCATGGCACCCCTGAGACCCCTTCTCATACTGGCCCTGCTGGCATGGGTTGCTCTGGCTGACCAAGAGTCATGCAAGGGCCGCTGCACTGAGGGCTTCAACGTGGACAAGAAGTGCCAGTGTGACGAGCTCTGCTCTTACTACCAGAGCTGCTGCACAGACTATACGGCTGAGTGCAAGCCCCAAGTGACTCGCGGGGATGTGTTCACTATGCCGGAGGATGAGTACACGGTCTATGACGATGGCGAGGAGAAAAACAATGCCACTGTCCATGAACAGGTGGGGGGCCCCTCCCTGACCTCTGACCTCCAGGCCCAGTCCAAAGGGAATCCTGAGCAGACACCTGTTCTGAAACCTGAGGAAGAGGCCCCTGCGCCTGAGGTGGGCGCCTCTAAGCCTGAGGGGATAGACTCAAGGCCTGAGACCCTTCATCCAGGGAGACCTCAGCCCCCAGCAGAGGAGGAGCTGTGCAGTGGGAAGCCCTTCGACGCCTTCACCGACCTCAAGAACGGTTCCCTCTTTGCCTTCCGAGGGCAGTACTGCTATGAACTGGACGAAAAGGCAGTGAGGCCTGGGTACCCCAAGCTCATCCGAGATGTCTGGGGCATCGAGGGCCCCATCGATGCCGCCTTCACCCGCATCAACTGTCAGGGGAAGACCTACCTCTTCAAGGGTAGTCAGTACTGGCGCTTTGAGGATGGTGTCCTGGACCCTGATTACCCCCGAAATATCTCTGACGGCTTCGATGGCATCCCGGACAACGTGGATGCAGCCTTGGCCCTCCCTGCCCATAGCTACAGTGGCCGGGAGCGGGTCTACTTCTTCAAGGGGAAACAGTACTGGGAGTACCAGTTCCAGCACCAGCCCAGTCAGGAGGAGTGTGAAGGCAGCTCCCTGTCGGCTGTGTTTGAACACTTTGCCATGATGCAGCGGGACAGCTGGGAGGACATCTTCGAGCTTCTCTTCTGGGGCAGAACCTCTGCTGGTACCAGACAGCCCCAGTTCATTAGCCGGGACTGGCACGGTGTGCCAGGGCAAGTGGACGCAGCCATGGCTGGCCGCATCTACATCTCAGGCATGGCACCCCGCCCCTCCTTGGCCAAGAAACAAAGGTTTAGGCATCGCAACCGCAAAGGCTACCGTTCACAACGAGGCCACAGCCGTGGCCGCAACCAGAACTCCCGCCGGCCATCCCGCGCCACGTGGCTGTCCTTGTTCTCCAGTGAGGAGAGCAACTTGGGAGCCAACAACTATGATGACTACAGGATGGACTGGCTTGTGCCTGCCACCTGTGAACCCATCCAGAGTGTCTTCTTCTTCTCTGGAGACAAGTACTACCGAGTCAATCTTCGCACACGGCGAGTGGACACTGTGGACCCTCCCTACCCACGCTCCATCGCTCAGTACTGGCTGGGCTGCCCAGCTCCTGGCCATCTGTAGGAGTCAGAGCCCACATGGCCGGGCCCTCTGTAGCTCCCTCCTCCCATCTCCTTCCCCCAGCCCAATAAAGGTCCCTTAGCCCCGA