Transcript asmbl_63622

Sequence
Transcript Sequence for observation asmbl_63622 of TGE0059337:
GTGGGTGGGGCAGCCCCGAGCAGCAGTGCTAAAGGAGCCCGGCGGAGGCAGCGGTGGGTTTGGGACTGAGGCGCTGGATCTGTGGTCGCGGCTGGGGACGTGCGCCCGCGCCACCATCTTCGGCTGAAGTAACTGAGGGCAAACCCATCAGACAACCAGAGCCATAATTTGTGGTCACCGCTGAAATTTACCTTGGAAACTCGAGGCAATTGCTTTTGGATCGTTCCATTTACAATGGCGCAGAGAACTGGACTCGAGGATCCAGAGAGGTATCTCTTTGTGGACAGGGCTGTCATCTACAACCCTGCCACTCAAGCTGATTGGACAGCTAAAAAGCTAGTGTGGATTCCATCAGAACGCCATGGTTTTGAGGCAGCTAGTATCAAAGAAGAACGGGGAGATGAAGTTATGGTGGAGTTGGCAGAGAATGGAAAGAAAGCAATGGTCAACAAAGATGATATTCAGAAGATGAACCCACCTAAGTTTTCCAAGGTGGAGGATATGGCAGAATTGACATGCTTGAATGAAGCTTCCGTTTTACATAATCTGAAGGATCGCTACTATTCAGGACTAATCTATACTTATTCTGGACTCTTCTGTGTAGTTATAAACCCTTACAAGAATCTTCCAATTTACTCTGAGAATATTATTGAAATGTACAGAGGGAAGAAGCGTCATGAGATGCCTCCACACATCTATGCTATATCTGAATCTGCTTACAGATGCATGCTTCAAGATCGTGAGGACCAGTCAATTCTTTGCACGGGTGAGTCAGGTGCTGGGAAGACAGAAAATACAAAGAAAGTTATTCAGTACCTTGCCCATGTTGCTTCTTCACATAAAGGAAGAAAGGACCATAATATTCCTGGGGAACTTGAACGGCAGCTTTTGCAAGCAAATCCAATTCTGGAATCATTTGGAAATGCGAAGACTGTGAAAAATGATAACTCATCTCGTTTTGGCAAATTTATTCGGATCAACTTTGATGTAACTGGCTATATCGTTGGGGCCAACATTGAAACATACCTTCTGGAAAAGTCTCGTGCTGTTCGTCAAGCAAAAGATGAACGTACTTTTCATATCTTTTACCAGTTGTTATCTGGAGCAGGAGAACACCTAAAGTCTGATTTGCTTCTTGAAGGATTTAATAACTACAGGTTTCTCTCCAATGGCTATATTCCTATTCCGGGACAGCAAGACAAAGATAATTTCCAGGAGACCATGGAAGCAATGCACATAATGGGCTTCTCCCATGAAGAGATTCTGTCAATGCTTAAAGTAGTATCTTCAGTGCTACAGTTTGGAAATATTTCTTTCAAAAAGGAGAGAAATACTGATCAAGCTTCCATGCCAGAAAATACAGTTGCGCAGAAGCTCTGCCATCTTCTTGGGATGAATGTGATGGAGTTTACTCGGGCCATCCTGACTCCCCGGATCAAGGTCGGCCGAGACTATGTGCAAAAAGCCCAGACCAAAGAACAGGCAGATTTTGCAGTAGAAGCATTGGCAAAAGCTACCTATGAGCGGCTCTTTCGCTGGCTCGTTCATCGCATCAATAAAGCTCTGGATAGGACCAAACGTCAGGGAGCATCTTTCATTGGAATCCTGGATATTGCTGGATTTGAAATTTTTGAGCTGAACTCCTTTGAACAACTTTGCATCAACTACACCAATGAGAAGCTGCAGCAGCTGTTCAACCACACCATGTTTATCCTAGAACAAGAGGAATACCAGCGCGAAGGCATCGAGTGGAACTTCATCGATTTCGGGCTGGATCTGCAGCCATGCATCGACCTAATAGAGAGACCTGCGAACCCTCCTGGTGTACTGGCCCTTTTGGATGAAGAATGCTGGTTCCCTAAAGCCACAGATAAAACCTTTGTTGAAAAACTGGTTCAAGAGCAAGGTTCCCACTCCAAGTTTCAGAAACCTCGACAATTAAAAGACAAAGCTGATTTTTGCATTATACATTATGCAGGGAAGGTGGACTATAAGGCAGATGAGTGGCTGATGAAGAATATGGACCCCCTGAATGACAACGTGGCCACCCTTTTGCACCAGTCATCAGACAGATTTGTGGCAGAGCTTTGGAAAGATGTGGACCGTATCGTGGGTCTGGATCAAGTCACTGGTATGACTGAGACAGCTTTTGGCTCCGCATATAAAACCAAGAAGGGCATGTTTCGTACCGTTGGGCAACTCTACAAAGAATCTCTCACCAAGCTGATGGCAACTCTCCGAAACACCAACCCTAACTTTGTTCGTTGTATCATTCCAAATCACGAGAAGAGGGCTGGAAAATTGGATCCACACCTAGTCCTAGATCAGCTTCGCTGTAACGGTGTCCTGGAAGGGATCCGAATCTGTCGCCAGGGCTTCCCTAACCGAATAGTTTTCCAGGAATTCAGACAGAGATATGAGATCCTAACTCCAAATGCTATTCCTAAAGGTTTTATGGATGGTAAACAGGCCTGTGAACGAATGATCCGGGCTTTAGAATTGGACCCAAACTTGTACAGAATTGGACAGAGCAAGATATTTTTCAGAGCTGGAGTTCTGGCACACTTAGAGGAAGAAAGAGATTTAAAAATCACCGATATCATTATCTTCTTCCAGGCCGTTTGCAGAGGTTACCTGGCCAGAAAGGCCTTTGCCAAGAAGCAGCAGCAACTAAGTGCCTTAAAGGTCTTGCAGCGGAACTGTGCCGCGTACCTGAAATTACGGCACTGGCAGTGGTGGCGAGTCTTCACAAAGGTGAAGCCGCTTCTACAAGTGACTCGCCAGGAGGAAGAACTTCAGGCCAAAGATGAAGAGCTGTTGAAGGTGAAGGAGAAGCAGACGAAGGTGGAAGGAGAGCTGGAGGAGATGGAGCGGAAGCACCAGCAGCTTTTAGAAGAGAAGAATATCCTTGCAGAACAACTACAAGCAGAGACTGAGCTCTTTGCTGAAGCAGAAGAGATGAGGGCAAGACTTGCTGCTAAAAAGCAGGAATTAGAAGAGATTCTACATGACTTGGAGTCTAGGGTTGAAGAAGAAGAAGAAAGAAACCAAATCCTCCAAAATGAAAAGAAAAAAATGCAAGCACATATTCAGGACCTGGAAGAACAGCTAGACGAGGAGGAAGGGGCTCGGCAAAAGCTGCAGCTGGAAAAGGTGACAGCAGAGGCCAAGATCAAGAAGATGGAAGAGGAGATTCTGCTTCTCGAGGACCAAAATTCCAAGTTCATCAAAGAAAAGAAACTCATGGAAGATCGCATTGCTGAGTGTTCCTCTCAGCTGGCTGAAGAGGAAGAAAAGGCGAAAAACTTGGCCAAAATCAGGAATAAGCAAGAAGTGATGATCTCAGATTTAGAAGAACGCTTAAAGAAGGAAGAAAAGACTCGTCAGGAACTGGAAAAGGCCAAAAGAAAACTCGACGGGGAGACGACCGACCTGCAGGACCAGATCGCAGAGCTGCAGGCGCAGATTGATGAGCTCAAGCTGCAGCTGGCCAAGAAGGAGGAGG