Transcript asmbl_63338

Sequence
Transcript Sequence for observation asmbl_63338 of TGE0059648:
CGGGCCCTGGGCGGGGAGAGTGCGCCCGGGCCGCGGATCCCCAAGCCCGCCACGCCGCCCAGCCCGGCCCCGCCCGCGCCGGAAGAGCCACGCCGGCCCTGGGCAGTGACGGGGTTCGGGTGACCATGGAGAGTGCGCTCACCGCCCGTGACCGGGTGGGGGTGCAGGATTTCGTGCTGCTGGAGAACTTCACCAGCGAGGCCGCCTTCATCGAGAACCTGCGGCGGCGATTTCGGGAGAATCTCATCTACACCTACATTGGCCCCGTCCTGGTCTCTGTCAATCCCTACCGGGACCTGCAGATCTACAGCCGGCAGCATATGGAGCGTTACCGTGGCGTCAGCTTCTATGAAGTGCCCCCTCACCTGTTTGCCGTGGCGGACACTGTGTACCGAGCACTGCGCACGGAGCGTCGGGACCAGGCTGTGATGATCTCTGGGGAGAGCGGGGCAGGCAAGACCGAGGCCACCAAGAGGCTGCTGCAGTTCTATGCAGAGACCTGCCCAGCCCCCGAGCGCGGAGGTGCCGTGCGGGACCGGCTGCTACAGAGCAACCCGGTGCTGGAGGCCTTTGGAAATGCCAAGACCCTCCGGAACGATAACTCCAGCAGGTTCGGGAAGTACATGGATGTGCAGTTTGACTTCAAGGGTGCCCCCGTGGGTGGCCACATCCTCAGTTACCTCCTGGAAAAGTCACGAGTGGTGCACCAGAATCATGGGGAGCGGAACTTCCACATCTTCTACCAGCTGCTGGAGGGGGGCGAGGAGGAGACTCTTCGCAGGCTGGGCTTGGAACGGAACCCCCAGAGCTACCTGTACCTGGTGAAGGGCCAGTGTGCCAAAGTCTCCTCCATCAACGACAAGAGTGACTGGAAGGTCGTCAGGAAGGCTCTGACAGTCATTGATTTCACCGAGGATGAAGTGGAGGACCTGCTGAGCATCGTGGCCAGCGTCCTTCATTTGGGCAACATCCACTTTGCTGCCAACGAGGAGAGCAATGCCCAGGTCACCACCGAGAACCAGCTCAAGTATCTGACCAGGCTCCTCAGCGTGGAAGGCTCGACGCTGCGAGAAGCCCTGACACACAGGAAGATCATCGCCAAGGGGGAGGAGCTCCTGAGCCCGCTGAACCTGGAGCAGGCCGCGTACGCACGAGACGCCCTCGCCAAGGCTGTGTACAGCCGCACTTTTACCTGGCTCGTCGGGAAGATCAACAGGTCGCTGGCCTCCAAGGACGTGGAGAGCCCCAGCTGGCGGAGCACCACGGTTCTCGGGCTCCTGGATATTTATGGCTTTGAAGTGTTTCAGCATAACAGCTTTGAGCAGTTCTGCATCAATTACTGCAACGAGAAGCTGCAGCAGCTCTTCATCGAGCTCACGCTCAAGTCGGAGCAGGAGGAGTACGAGGCAGAGGGCATCGCGTGGGAGCCCGTCCAGTATTTCAACAACAAAATCATCTGTGATCTGGTGGAGGAGAAGTTTAAGGGCATCATCTCGATTTTGGATGAGGAGTGTCTGCGCCCCGGGGAGGCCACAGACCTGACCTTCCTGGAGAAGCTGGAGGATACTGTCAAGCACCATCCACACTTCCTGACGCACAAGCTGGCTGACCAGCGGACCAGGAAATCTCTGGGCCGAGGGGAATTCCGCCTTCTGCACTATGCGGGGGAGGTGACCTACAGCGTGACCGGGTTTCTGGACAAAAACAATGACCTTCTCTTCCGGAACCTTAAGGAGACCATGTGTAGCTCAAAGAATCCCATTATGAGCCAGTGCTTTGACCGGAGCGAGCTCAGTGACAAGAAGCGGCCAGAGACGGTCGCCACCCAGTTCAAGATGAGCCTCCTGCAGCTGGTGGAGATCCTGCAGTCTAAGGAGCCCGCCTACGTCCGCTGCATCAAACCCAATGATGCCAAACAGCCCGGCCGCTTTGACGAGGTGCTGATCCGCCACCAGGTGAAGTACCTGGGGCTGTTGGAAAACCTGCGCGTGCGCAGAGCCGGCTTTGCCTATCGCCGCAAATACGAAGCTTTCCTGCAAAGGTACAAGTCACTGTGCCCAGAGACGTGGCCCACGTGGGCAGGACGGCCGCAGGATGGGGTGGCTGTGCTGGTCCGACACCTGGGCTACAAGCCAGAAGAGTACAAGATGGGCAGGACCAAGATCTTCATCCGCTTCCCCAAGACCCTGTTTGCCACAGAGGATGCCCTGGAGGTCCGGCGGCAGAGCCTGGCCACAAAGATCCAAGCTGCCTGGAGGGGCTTTCACTGGCGGCAGAAATTCCTCCGGGTGAAGAGATCAGCCATCTGCATCCAGTCGTGGTGGCGTGGAACACTGGGCCGGAGGAAGGCAGCCAAGAGGAAGTGGGCGGCACAGACCATCCGGCGGCTCATCCGAGGCTTCGTCCTGCGCCACGCCCCCCGCTGCCCCGAGAACGCCTTCTTCCTGGACCATGTGCGCACCTCTTTTTTGCTAAACCTGAGGCGGCAGCTGCCCCAGAATGTCCTGGACACCTCGTGGCCCACGCCCCCACCTGCCCTGCGTGAGGCCTCAGAGCTTCTGCGGGAGTTGTGCATAAAGAACATGGTGTGGAAATACTGCCGGAGTATCAGCCCTGAGTGGAAGCAGCAGCTGCAGCAGAAGGCCGTGGCTAGTGAGATCTTCAAGGGCAAGAAGGATAATTACCCTCAGAGTGTACCCAGGCTCTTCATCAGCACTCGGCTTGGTGAGCCCCTGACTTTCCAGCACTCAGACCTTTCGTCACCATCCTGGTCCCCCATTGCCTCCACTGACTTCCCTCCCCGCCATCTGAGTTGCAGGTACAGATGAGATCAGCCCCCGAGTGCTGCAGGCCTTGGGCTCTGAGCCCATTCAGGTAAGAGCCTGCCTGCAGCCCTGAGTCCAGCAGCACGGTGCTACTGCCTGAGAGCTGAAGGCAGGTCAGGGCAGGGGCGGAGCCTTGGGAGCCTCTCCCCAGCCCCTTCAGCCTGGCCTCTGTCCCCAGTATGCGGTGCCTGTTGTGAA