Transcript asmbl_63337

Sequence
Transcript Sequence for observation asmbl_63337 of TGE0058316:
CGAGGTCTATAGGGGGTCTGGAGGTGCCTTCACGCTCTATCTCAGGCCACCCAACGGCCCTTCTAGGCCTGTGTTAGCCTCATGTTAGGGATGAAGAACAGAAGCCGAAACGTTAAGTGACTTGCTCAGAGTCCCACCGCGAGGAAGAACCAGCCCAGCCTTTTGCAGACTCTAGACGTCCCCGCCCCTGCCCGCGGTGGGATCTGAGCCAAGGCCCTGGGCAGTGACGGGGTTCGGGTGACCATGGAGAGTGCGCTCACCGCCCGTGACCGGGTGGGGGTGCAGGATTTCGTGCTGCTGGAGAACTTCACCAGCGAGGCCGCCTTCATCGAGAACCTGCGGCGGCGATTTCGGGAGAATCTCATCTACACCTACATTGGCCCCGTCCTGGTCTCTGTCAATCCCTACCGGGACCTGCAGATCTACAGCCGGCAGCATATGGAGCGTTACCGTGGCGTCAGCTTCTATGAAGTGCCCCCTCACCTGTTTGCCGTGGCGGACACTGTGTACCGAGCACTGCGCACGGAGCGTCGGGACCAGGCTGTGATGATCTCTGGGGAGAGCGGGGCAGGCAAGACCGAGGCCACCAAGAGGCTGCTGCAGTTCTATGCAGAGACCTGCCCAGCCCCCGAGCGCGGAGGTGCCGTGCGGGACCGGCTGCTACAGAGCAACCCGGTGCTGGAGGCCTTTGGAAATGCCAAGACCCTCCGGAACGATAACTCCAGCAGGTTCGGGAAGTACATGGATGTGCAGTTTGACTTCAAGGGTGCCCCCGTGGGTGGCCACATCCTCAGTTACCTCCTGGAAAAGTCACGAGTGGTGCACCAGAATCATGGGGAGCGGAACTTCCACATCTTCTACCAGCTGCTGGAGGGGGGCGAGGAGGAGACTCTTCGCAGGCTGGGCTTGGAACGGAACCCCCAGAGCTACCTGTACCTGGTGAAGGGCCAGTGTGCCAAAGTCTCCTCCATCAACGACAAGAGTGACTGGAAGGTCGTCAGGAAGGCTCTGACAGTCATTGATTTCACCGAGGATGAAGTGGAGGACCTGCTGAGCATCGTGGCCAGCGTCCTTCATTTGGGCAACATCCACTTTGCTGCCAACGAGGAGAGCAATGCCCAGGTCACCACCGAGAACCAGCTCAAGTATCTGACCAGGCTCCTCAGCGTGGAAGGCTCGACGCTGCGAGAAGCCCTGACACACAGGAAGATCATCGCCAAGGGGGAGGAGCTCCTGAGCCCGCTGAACCTGGAGCAGGCCGCGTACGCACGAGACGCCCTCGCCAAGGCTGTGTACAGCCGCACTTTTACCTGGCTCGTCGGGAAGATCAACAGGTCGCTGGCCTCCAAGGACGTGGAGAGCCCCAGCTGGCGGAGCACCACGGTTCTCGGGCTCCTGGATATTTATGGCTTTGAAGTGTTTCAGCATAACAGCTTTGAGCAGTTCTGCATCAATTACTGCAACGAGAAGCTGCAGCAGCTCTTCATCGAGCTCACGCTCAAGTCGGAGCAGGAGGAGTACGAGGCAGAGGGCATCGCGTGGGAGCCCGTCCAGTATTTCAACAACAAAATCATCTGTGATCTGGTGGAGGAGAAGTTTAAGGGCATCATCTCGATTTTGGATGAGGAGTGTCTGCGCCCCGGGGAGGCCACAGACCTGACCTTCCTGGAGAAGCTGGAGGATACTGTCAAGCACCATCCACACTTCCTGACGCACAAGCTGGCTGACCAGCGGACCAGGAAATCTCTGGGCCGAGGGGAATTCCGCCTTCTGCACTATGCGGGGGAGGTGACCTACAGCGTGACCGGGTTTCTGGACAAAAACAATGACCTTCTCTTCCGGAACCTTAAGGAGACCATGTGTAGCTCAAAGAATCCCATTATGAGCCAGTGCTTTGACCGGAGCGAGCTCAGTGACAAGAAGCGGCCAGAGACGGTCGCCACCCAGTTCAAGATGAGCCTCCTGCAGCTGGTGGAGATCCTGCAGTCTAAGGAGCCCGCCTACGTCCGCTGCATCAAACCCAATGATGCCAAACAGCCCGGCCGCTTTGACGAGGTGCTGATCCGCCACCAGGTGAAGTACCTGGGGCTGTTGGAAAACCTGCGCGTGCGCAGAGCCGGCTTTGCCTATCGCCGCAAATACGAAGCTTTCCTGCAAAGGTACAAGTCACTGTGCCCAGAGACGTGGCCCACGTGGGCAGGACGGCCGCAGGATGGGGTGGCTGTGCTGGTCCGACACCTGGGCTACAAGCCAGAAGAGTACAAGATGGGCAGGACCAAGATCTTCATCCGCTTCCCCAAGACCCTGTTTGCCACAGAGGATGCCCTGGAGGTCCGGCGGCAGAGCCTGGCCACAAAGATCCAAGCTGCCTGGAGGGGCTTTCACTGGCGGCAGAAATTCCTCCGGGTGAAGAGATCAGCCATCTGCATCCAGTCGTGGTGGCGTGGAACACTGGGCCGGAGGAAGGCAGCCAAGAGGAAGTGGGCGGCACAGACCATCCGGCGGCTCATCCGAGGCTTCGTCCTGCGCCACGCCCCCCGCTGCCCCGAGAACGCCTTCTTCCTGGACCATGTGCGCACCTCTTTTTTGCTAAACCTGAGGCGGCAGCTGCCCCAGAATGTCCTGGACACCTCGTGGCCCACGCCCCCACCTGCCCTGCGTGAGGCCTCAGAGCTTCTGCGGGAGTTGTGCATAAAGAACATGGTGTGGAAATACTGCCGGAGTATCAGCCCTGAGTGGAAGCAGCAGCTGCAGCAGAAGGCCGTGGCTAGTGAGATCTTCAAGGGCAAGAAGGATAATTACCCTCAGAGTGTACCCAGGCTCTTCATCAGCACTCGGCTTGGTACAGATGAGATCAGCCCCCGAGTGCTGCAGGCCTTGGGCTCTGAGCCCATTCAGTATGCGGTGCCTGTTGTGAAATACGACCGCAAGGGCTACAAGCCTCGCTCCCGGCAGCTGCTGCTCACGCCCAACGCCGTCGTCATCGTGGAGGACGCCAAAGTCAAGCAGAGGATTGATTACGCCAACCTGACCGGAATCTCTGTCAGCAGCCTGAGCGACAGTCTTTTTGTGCTTCATGTACAGCGTGCGGACAATAAGCAAAAGGGAGATGTGGTGCTGCAGAGTGACCACGTGATTGAGACGCTGACCAAGACAGCCCTCAGTGCCAACCGCGTGAACAGCATCAACATCAACCAGGGCAGCATCACGTTTGCAGGGGGCCCCGGCAGGGATGGCACCATTGACTTCACACCCGGCTCGGAGCTGCTCATCACCAAGGCCAAGAACGGGCACCTGGCTGTGGTCGCCCCACGGCTGAATTCTCGGTGATAAAGGCGCCCACTGGACCCTCCCAACGCCCAATGCTTTGCTTTTCTCCTCCTCCCCTTCCCAGTTACCAAAGACTCGAACTTCCAGACAGGGACCCAGGGACACCCCGAAGCCCACCTGCAATCTCCCACCTCCTGCCCATCCCTCTCTTGAGGGAGCAGCAGGGGCCAGGAGCTACCCCAGGAGTGGGCCAGGCCGGGCCACAGCAATAGGAAAGCCAGGGCCAGAGCGAGCCATGCCAGCCCTACTGCCGATGCCAAATATTTGAGAGAAGGGAACTTTTGCTGAGGTTTTCTCTGAGGTTTTTTTGATGCTTTATAGGAAACTATTTTTTAAAAAAAGCCATTTCCCACCCAAGGACACAGTGGATGTGTTTTCCCTGACTCCAGCAGGGCAAGGAATGTAGCCGAGAGGTTGTGTGGGCTGGGCTCTGGTGCCCTCTTCCCTGGCCAGGACACCTCTCCTCCTGATTCCCTTGGCACCTTGTCTTTCTGTCTGTTTACCTGTCTCCCTGCCTGCCCATCTGCATCTTTTGCAGCCCACTCTGACTTCCATCTGGGGGCTGAGACCACCCTTGCCTGCCCCCTTCTTTCTGCCTTAAGAATGTCCTTTTAGGCTGGGCATGGTGGCTCACGCCTGTAACCCCAGCACTTTGGGA