Transcript asmbl_63335

Sequence
Transcript Sequence for observation asmbl_63335 of TGE0059647:
CCGGGCTCCACCCTGGTGCCAACGGCGTCCCTCCTGGAAAACCTGACTCAGGCGGAGCCCGCCCCCGCCCCCGGCCCGCGGACCCCCCGCCCCGACACCCCCACCTCCACCAACCCCACCTGGAGGGGACCCCAGCCCGGCCGCGCGGGAGGCGGGGGAGGCCGGGGAAGCCCCGCGCTTCAGGGGCCCGGGTGGGGGCGGTGCGGGGGGCGGGCCCTCCCTCGCTGACGCCGCCGCCACCGCCGCCGAGCCCGGGACCCGGAGCGCGGGCAGCGGAGCGGGCGCCAGGCCGGCCGGGCAGGATGCGCTACCGGGCGTCGGCCCTGGGCAGTGACGGGGTTCGGGTGACCATGGAGAGTGCGCTCACCGCCCGTGACCGGGTGGGGGTGCAGGATTTCGTGCTGCTGGAGAACTTCACCAGCGAGGCCGCCTTCATCGAGAACCTGCGGCGGCGATTTCGGGAGAATCTCATCTACACCTACATTGGCCCCGTCCTGGTCTCTGTCAATCCCTACCGGGACCTGCAGATCTACAGCCGGCAGCATATGGAGCGTTACCGTGGCGTCAGCTTCTATGAAGTGCCCCCTCACCTGTTTGCCGTGGCGGACACTGTGTACCGAGCACTGCGCACGGAGCGTCGGGACCAGGCTGTGATGATCTCTGGGGAGAGCGGGGCAGGCAAGACCGAGGCCACCAAGAGGCTGCTGCAGTTCTATGCAGAGACCTGCCCAGCCCCCGAGCGCGGAGGTGCCGTGCGGGACCGGCTGCTACAGAGCAACCCGGTGCTGGAGGCCTTTGGAAATGCCAAGACCCTCCGGAACGATAACTCCAGCAGGTTCGGGAAGTACATGGATGTGCAGTTTGACTTCAAGGGTGCCCCCGTGGGTGGCCACATCCTCAGTTACCTCCTGGAAAAGTCACGAGTGGTGCACCAGAATCATGGGGAGCGGAACTTCCACATCTTCTACCAGCTGCTGGAGGGGGGCGAGGAGGAGACTCTTCGCAGGCTGGGCTTGGAACGGAACCCCCAGAGCTACCTGTACCTGGTGAAGGGCCAGTGTGCCAAAGTCTCCTCCATCAACGACAAGAGTGACTGGAAGGTCGTCAGGAAGGCTCTGACAGTCATTGATTTCACCGAGGATGAAGTGGAGGACCTGCTGAGCATCGTGGCCAGCGTCCTTCATTTGGGCAACATCCACTTTGCTGCCAACGAGGAGAGCAATGCCCAGGTCACCACCGAGAACCAGCTCAAGTATCTGACCAGGCTCCTCAGCGTGGAAGGCTCGACGCTGCGAGAAGCCCTGACACACAGGAAGATCATCGCCAAGGGGGAGGAGCTCCTGAGCCCGCTGAACCTGGAGCAGGCCGCGTACGCACGAGACGCCCTCGCCAAGGCTGTGTACAGCCGCACTTTTACCTGGCTCGTCGGGAAGATCAACAGGTCGCTGGCCTCCAAGGACGTGGAGAGCCCCAGCTGGCGGAGCACCACGGTTCTCGGGCTCCTGGATATTTATGGCTTTGAAGTGTTTCAGCATAACAGCTTTGAGCAGTTCTGCATCAATTACTGCAACGAGAAGCTGCAGCAGCTCTTCATCGAGCTCACGCTCAAGTCGGAGCAGGAGGAGTACGAGGCAGAGGGCATCGCGTGGGAGCCCGTCCAGTATTTCAACAACAAAATCATCTGTGATCTGGTGGAGGAGAAGTTTAAGGGCATCATCTCGATTTTGGATGAGGAGTGTCTGCGCCCCGGGGAGGCCACAGACCTGACCTTCCTGGAGAAGCTGGAGGATACTGTCAAGCACCATCCACACTTCCTGACGCACAAGCTGGCTGACCAGCGGACCAGGAAATCTCTGGGCCGAGGGGAATTCCGCCTTCTGCACTATGCGGGGGAGGTGACCTACAGCGTGACCGGGTTTCTGGACAAAAACAATGACCTTCTCTTCCGGAACCTTAAGGAGACCATGTGTAGCTCAAAGAATCCCATTATGAGCCAGTGCTTTGACCGGAGCGAGCTCAGTGACAAGAAGCGGCCAGAGACGGTCGCCACCCAGTTCAAGATGAGCCTCCTGCAGCTGGTGGAGATCCTGCAGTCTAAGGAGCCCGCCTACGTCCGCTGCATCAAACCCAATGATGCCAAACAGCCCGGCCGCTTTGACGAGGTGCTGATCCGCCACCAGGTGAAGTACCTGGGGCTGTTGGAAAACCTGCGCGTGCGCAGAGCCGGCTTTGCCTATCGCCGCAAATACGAAGCTTTCCTGCAAAGGTACAAGTCACTGTGCCCAGAGACGTGGCCCACGTGGGCAGGACGGCCGCAGGATGGGGTGGCTGTGCTGGTCCGACACCTGGGCTACAAGCCAGAAGAGTACAAGATGGGCAGGACCAAGATCTTCATCCGCTTCCCCAAGACCCTGTTTGCCACAGAGGATGCCCTGGAGGTCCGGCGGCAGAGCCTGGCCACAAAGATCCAAGCTGCCTGGAGGGGCTTTCACTGGCGGCAGAAATTCCTCCGGGTGAAGAGATCAGCCATCTGCATCCAGTCGTGGTGGCGTGGAACACTGGGCCGGAGGAAGGCAGCCAAGAGGAAGTGGGCGGCACAGACCATCCGGCGGCTCATCCGAGGCTTCGTCCTGCGCCACGCCCCCCGCTGCCCCGAGAACGCCTTCTTCCTGGACCATGTGCGCACCTCTTTTTTGCTAAACCTGAGGCGGCAGCTGCCCCAGAATGTCCTGGACACCTCGTGGCCCACGCCCCCACCTGCCCTGCGTGAGGCCTCAGAGCTTCTGCGGGAGTTGTGCATAAAGAACATGGTGTGGAAATACTGCCGGAGTATCAGCCCTGAGTGGAAGCAGCAGCTGCAGCAGAAGGCCGTGGCTAGTGAGATCTTCAAGGGCAAGAAGGATAATTACCCTCAGAGTGTACCCAGGCTCTTCATCAGCACTCGGCTTGGTACAGATGAGATCAGCCCCCGAGTGCTGCAGGCCTTGGGCTCTGAGCCCATTCAGTATGCGGTGCCTGTTGTGAAATACGACCGCAAGGGCTACAAGCCTCGCTCCCGGCAGCTGCTGCTCACGCCCAACGCCGTCGTCATCGTGGAGGACGCCAAAGTCAAGCAGAGGATTGATTACGCCAACCTGACCGGAATCTCTGTCAGCAGCCTGAGCGACAGTCTTTTTGTGCTTCATGTACAGCGTGCGGACAATAAGCAAAAGGGAGATGTGGTGCTGCAGAGTGACCACGTGATTGAGACGCTGACCAAGACAGCCCTCAGTGCCAACCGCGTGAACAGCATCAACATCAACCAGGGCAGCATCACGTTTGCAGGGGGCCCCGGCAGGGATGGCACCATTGACTTCACACCCGGCTCGGAGCTGCTCATCACCAAGGCCAAGAACGGGCACCTGGCTGTGGTCGCCCCACGGCTGAATTCTCGGTGATAAAGGCGCCCACTGGACCCTCCCAACGCCCAATGCTTTGCTTTTCTCCTCCTCCCCTTCCCAGTTACCAAAGACTCGAACTTCCAGACAGGGACCCAGGGACACCCCGAAGCCCACCTGCAATCTCCCACCTCCTGCCCATCCCTCTCTTGAGGGAGCAGCAGGGGCCAGGAGCTACCCCAGGAGTGGGCCAGGCCGGGCCACAGCAATAGGAAAGCCAGGGCCAGAGCGAGCCATGCCAGCCCTACTGCCGATGCCAAATATTTGAGAGAAGGGAACTTTTGCTGAGGTTTTCTCTGAGGTTTTTTTGATGCTTTATAGGAAACTATTTTTTAAAAAAAGCCATTTCCCACCCAAGGACACAGTGGATGTGTTTTCCCTGACTCCAGCAGGGCAAGGAATGTAGCCGAGAGGTTGTGTGGGCTGGGCTCTGGTGCCCTCTTCCCTGGCCAGGACACCTCTCCTCCTGATTCCCTTGGCACCTTGTCTTTCTGTCTGTTTACCTGTCTCCCTGCCTGCCCATCTGCATCTTTTGCAGCCCACTCTGACTTCCATCTGGGGGCTGAGACCACCCTTGCCTGCCCCCTTCTTTCTGCCTTAAGAATGTCCTTTTAGGCTGGGCATGGTGGCTCACGCCTGTAACCCCAGCACTTTGGGA