Transcript asmbl_63334

Sequence
Transcript Sequence for observation asmbl_63334 of TGE0059646:
CGGGCCCTGGGCGGGGAGAGTGCGCCCGGGCCGCGGATCCCCAAGCCCGCCACGCCGCCCAGCCCGGCCCCGCCCGCGCCGGAAGAGCCACGCCGGCCCTGGGCAGTGACGGGGTTCGGGTGACCATGGAGAGTGCGCTCACCGCCCGTGACCGGGTGGGGGTGCAGGATTTCGTGCTGCTGGAGAACTTCACCAGCGAGGCCGCCTTCATCGAGAACCTGCGGCGGCGATTTCGGGAGAATCTCATCTACACCTACATTGGCCCCGTCCTGGTCTCTGTCAATCCCTACCGGGACCTGCAGATCTACAGCCGGCAGCATATGGAGCGTTACCGTGGCGTCAGCTTCTATGAAGTGCCCCCTCACCTGTTTGCCGTGGCGGACACTGTGTACCGAGCACTGCGCACGGAGCGTCGGGACCAGGCTGTGATGATCTCTGGGGAGAGCGGGGCAGGCAAGACCGAGGCCACCAAGAGGCTGCTGCAGTTCTATGCAGAGACCTGCCCAGCCCCCGAGCGCGGAGGTGCCGTGCGGGACCGGCTGCTACAGAGCAACCCGGTGCTGGAGGCCTTTGGAAATGCCAAGACCCTCCGGAACGATAACTCCAGCAGGTTCGGGAAGTACATGGATGTGCAGTTTGACTTCAAGGGTGCCCCCGTGGGTGGCCACATCCTCAGTTACCTCCTGGAAAAGTCACGAGTGGTGCACCAGAATCATGGGGAGCGGAACTTCCACATCTTCTACCAGCTGCTGGAGGGGGGCGAGGAGGAGACTCTTCGCAGGCTGGGCTTGGAACGGAACCCCCAGAGCTACCTGTACCTGGTGAAGGGCCAGTGTGCCAAAGTCTCCTCCATCAACGACAAGAGTGACTGGAAGGTCGTCAGGAAGGCTCTGACAGTCATTGATTTCACCGAGGATGAAGTGGAGGACCTGCTGAGCATCGTGGCCAGCGTCCTTCATTTGGGCAACATCCACTTTGCTGCCAACGAGGAGAGCAATGCCCAGGTCACCACCGAGAACCAGCTCAAGTATCTGACCAGGCTCCTCAGCGTGGAAGGCTCGACGCTGCGAGAAGCCCTGACACACAGGAAGATCATCGCCAAGGGGGAGGAGCTCCTGAGCCCGCTGAACCTGGAGCAGGCCGCGTACGCACGAGACGCCCTCGCCAAGGCTGTGTACAGCCGCACTTTTACCTGGCTCGTCGGGAAGATCAACAGGTCGCTGGCCTCCAAGGACGTGGAGAGCCCCAGCTGGCGGAGCACCACGGTTCTCGGGCTCCTGGATATTTATGGCTTTGAAGTGTTTCAGCATAACAGCTTTGAGCAGTTCTGCATCAATTACTGCAACGAGAAGCTGCAGCAGCTCTTCATCGAGCTCACGCTCAAGTCGGAGCAGGAGGAGTACGAGGCAGAGGGCATCGCGTGGGAGCCCGTCCAGTATTTCAACAACAAAATCATCTGTGATCTGGTGGAGGAGAAGTTTAAGGGCATCATCTCGATTTTGGATGAGGAGTGTCTGCGCCCCGGGGAGGCCACAGACCTGACCTTCCTGGAGAAGCTGGAGGATACTGTCAAGCACCATCCACACTTCCTGACGCACAAGCTGGCTGACCAGCGGACCAGGAAATCTCTGGGCCGAGGGGAATTCCGCCTTCTGCACTATGCGGGGGAGGTGACCTACAGCGTGACCGGGTTTCTGGACAAAAACAATGACCTTCTCTTCCGGAACCTTAAGGAGACCATGTGTAGCTCAAAGAATCCCATTATGAGCCAGTGCTTTGACCGGAGCGAGCTCAGTGACAAGAAGCGGCCAGAGACGGTCGCCACCCAGTTCAAGATGAGCCTCCTGCAGCTGGTGGAGATCCTGCAGTCTAAGGAGCCCGCCTACGTCCGCTGCATCAAACCCAATGATGCCAAACAGCCCGGCCGCTTTGACGAGGTGCTGATCCGCCACCAGGTGAAGTACCTGGGGCTGTTGGAAAACCTGCGCGTGCGCAGAGCCGGCTTTGCCTATCGCCGCAAATACGAAGCTTTCCTGCAAAGGTACAAGTCACTGTGCCCAGAGACGTGGCCCACGTGGGCAGGACGGCCGCAGGATGGGGTGGCTGTGCTGGTCCGACACCTGGGCTACAAGCCAGAAGAGTACAAGATGGGCAGGACCAAGATCTTCATCCGCTTCCCCAAGACCCTGTTTGCCACAGAGGATGCCCTGGAGGTCCGGCGGCAGAGCCTGGCCACAAAGATCCAAGCTGCCTGGAGGGGCTTTCACTGGCGGCAGAAATTCCTCCGGGTGAAGAGATCAGCCATCTGCATCCAGTCGTGGTGGCGTGGAACACTGGGCCGGAGGAAGGCAGCCAAGAGGAAGTGGGCGGCACAGACCATCCGGCGGCTCATCCGAGGCTTCGTCCTGCGCCACGCCCCCCGCTGCCCCGAGAACGCCTTCTTCCTGGACCATGTGCGCACCTCTTTTTTGCTAAACCTGAGGCGGCAGCTGCCCCAGAATGTCCTGGACACCTCGTGGCCCACGCCCCCACCTGCCCTGCGTGAGGCCTCAGAGCTTCTGCGGGAGTTGTGCATAAAGAACATGGTGTGGAAATACTGCCGGAGTATCAGCCCTGAGTGGAAGCAGCAGCTGCAGCAGAAGGCCGTGGCTAGTGAGATCTTCAAGGGCAAGAAGGATAATTACCCTCAGAGTGTACCCAGGCTCTTCATCAGCACTCGGCTTGGTACAGATGAGATCAGCCCCCGAGTGCTGCAGGCCTTGGGCTCTGAGCCCATTCAGTATGCGGTGCCTGTTGTGAAATACGACCGCAAGGGCTACAAGCCTCGCTCCCGGCAGCTGCTGCTCACGCCCAACGCCGTCGTCATCGTGGAGGACGCCAAAGTCAAGCAGAGGATTGATTACGCCAACCTGACCGGAATCTCTGTCAGCAGCCTGAGCGACAGTCTTTTTGTGCTTCATGTACAGCGTGCGGACAATAAGCAAAAGGGAGATGTGGTGCTGCAGAGTGACCACGTGATTGAGACGCTGACCAAGACAGCCCTCAGTGCCAACCGCGTGAACAGCATCAACATCAACCAGGGCAGCATCACGTTTGCAGGGGGCCCCGGCAGGGATGGCACCATTGACTTCACACCCGGCTCGGAGCTGCTCATCACCAAGGCCAAGAACGGGCACCTGGCTGTGGTCGCCCCACGGCTGAATTCTCGGTGATAAAGGCGCCCACTGGACCCTCCCAACGCCCAATGCTTTGCTTTTCTCCTCCTCCCCTTCCCAGTTACCAAAGACTCGAACTTCCAGACAGGGACCCAGGGACACCCCGAAGCCCACCTGCAATCTCCCACCTCCTGCCCATCCCTCTCTTGAGGGAGCAGCAGGGGCCAGGAGCTACCCCAGGAGTGGGCCAGGCCGGGCCACAGCAATAGGAAAGCCAGGGCCAGAGCGAGCCATGCCAGCCCTACTGCCGATGCCAAATATTTGAGAGAAGGGAACTTTTGCTGAGGTTTTCTCTGAGGTTTTTTTGATGCTTTATAGGAAACTATTTTTTAAAAAAAGCCATTTCCCACCCAAGGACACAGTGGATGTGTTTTCCCTGACTCCAGCAGGGCAAGGAATGTAGCCGAGAGGTTGTGTGGGCTGGGCTCTGGTGCCCTCTTCCCTGGCCAGGACACCTCTCCTCCTGATTCCCTTGGCACCTTGTCTTTCTGTCTGTTTACCTGTCTCCCTGCCTGCCCATCTGCATCTTTTGCAGCCCACTCTGACTTCCATCTGGGGGCTGAGACCACCCTTGCCTGCCCCCTTCTTTCTGCCTTAAGAATGTCCTTTTAGGCTGGGCATGGTGGCTCACGCCTGTAACCCCAGCACTTTGGGA