Transcript asmbl_62868

Sequence
Transcript Sequence for observation asmbl_62868 of TGE0000798:
AGTGGGGGGAGAAAGAGAAGACTGGCGAAAGTGATGAGTCTAAAAAAGTAGTCCCTCCGGTTCCTCTGTTTCCCCCCATGTGGCGTCAGGAAGCGAGGCACCGGGCGCACTGCGCCCCGAATTCCTGCGCCCGCCGCGCGCGGCGCTCCGTGGAGGGGTACATAAGGCGGAGGGGGTGAGGCGACTGGGCGGAGTTCTGTCGCCGGGATCCTTCCGCTGGGCTCAGCCGTTTCCGGAGTCTGCGCTGCGCCCGGTTCCGCCATTGCGGCTCTCCTGGCCCCTGGAGCCTCCGCCCCCGACCCGAGCTCTTTCGTCTGCCTGCCAGTTTCCTGCGTCCCCGGAGAGGATCCTGCTGAGCCCAGCCTCCCCCCTCCCCTTCTCCTCCTCTCCCTTGGAGAGCCCGGGCAGCCACTGCCCCGCAGCCCCAGTGACAGGAGGAGACCATAACCCCCGACAGCGCCATGGCCCAGATTCTGCCAATTCGTTTTCAGGAGCATCTCCAGCTCCAGAACCTGGGTATCAACCCAGCAAACATTGGCTTCAGTACCCTGACTATGGAGTCTGACAAATTCATCTGCATTAGAGAAAAAGTAGGAGAGCAGGCCCAGGTGGTAATCATTGATATGAATGACCCAAGTAATCCAATTCGAAGACCAATTTCAGCAGACAGCGCCATCATGAATCCAGCTAGCAAAGTAATTGCACTGAAAGCTGGGAAAACTCTTCAGATTTTTAACATTGAAATGAAAAGTAAAATGAAGGCTCATACCATGACTGATGATGTCACCTTTTGGAAATGGATCTCTTTGAATACGGTTGCTCTTGTTACGGATAATGCAGTTTATCACTGGAGTATGGAAGGAGAGTCTCAGCCAGTGAAAATGTTTGATCGCCATTCTAGCCTTGCAGGGTGCCAGATTATCAATTACCGTACAGATGCAAAACAAAAGTGGTTACTTCTGACTGGTATATCTGCACAGCAAAATCGTGTGGTGGGAGCTATGCAGCTATATTCTGTAGATAGGAAAGTGTCTCAGCCCATTGAAGGACATGCAGCTAGCTTTGCACAGTTTAAGATGGAAGGAAATGCAGAAGAATCAACGTTATTTTGTTTTGCAGTTCGGGGCCAAGCTGGAGGGAAGTTACATATTATTGAAGTTGGCACACCACCTACAGGGAACCAGCCCTTTCCAAAGAAGGCAGTGGATGTCTTCTTTCCTCCAGAAGCACAAAATGATTTTCCTGTTGCAATGCAGATCAGTGAAAAGCATGATGTGGTGTTCTTGATAACCAAGTATGGTTATATCCACCTCTATGATCTTGAGACTGGTACCTGCATCTACATGAATAGAATCAGTGGAGAAACAATTTTTGTTACTGCACCTCATGAAGCCACAGCTGGAATAATTGGAGTAAACAGAAAGGGACAAGTTCTGTCAGTGTGTGTGGAAGAAGAAAACATAATTCCTTACATCACCAATGTTCTACAAAATCCTGATTTGGCTCTGAGAATGGCTGTACGTAATAACTTAGCCGGTGCTGAAGAACTCTTTGCCCGGAAATTTAATGCTCTTTTTGCCCAGGGAAATTACTCGGAGGCAGCAAAGGTGGCTGCTAATGCACCAAAGGGAATTCTTCGTACTCCAGACACTATCCGTCGGTTCCAGAGTGTCCCAGCCCAGCCAGGTCAAACTTCTCCTCTACTTCAGTACTTTGGTATCCTTTTGGACCAGGGACAGCTCAACAAATACGAATCCTTAGAGCTTTGTAGGCCTGTACTTCAGCAAGGGCGAAAACAGCTTTTGGAGAAATGGTTAAAAGAAGATAAGCTGGAATGTTCTGAAGAACTGGGTGATCTTGTGAAATCTGTGGACCCTACATTGGCACTTAGTGTGTACCTAAGGGCTAACGTCCCAAATAAAGTCATTCAGTGCTTTGCAGAAACAGGTCAAGTCCAAAAGATTGTTTTATATGCTAAAAAAGTTGGATACACTCCAGATTGGATATTTCTGCTGAGAAATGTAATGCGAATCAGTCCAGATCAGGGACAGCAGTTTGCCCAAATGTTAGTTCAAGATGAAGAGCCTCTTGCTGACATCACACAGATTGTAGATGTCTTTATGGAATACAATCTAATTCAGCAGTGTACTGCATTCTTGCTTGATGCTCTGAAGAATAATCGCCCATCTGAAGGTCCTTTACAGACGCGGTTACTTGAGATGAACCTTATGCATGCGCCTCAAGTTGCAGATGCTATTCTAGGCAATCAGATGTTCACACATTATGACCGGGCTCATATTGCTCAACTGTGTGAAAAGGCTGGCCTACTGCAGCGTGCATTAGAACATTTCACTGATTTATATGATATAAAACGTGCAGTGGTTCACACCCATCTTCTTAACCCTGAGTGGTTAGTCAACTACTTTGGTTCCTTATCAGTAGAAGACTCCCTAGAATGTCTCAGAGCCATGCTGTCTGCCAACATCCGTCAGAATCTGCAGATTTGTGTTCAGGTGGCTTCTAAATATCATGAACAACTGTCAACTCAGTCTCTGATTGAACTTTTTGAATCTTTCAAGAGTTTTGAAGGTCTCTTTTATTTTCTGGGATCCATTGTTAACTTTAGCCAGGACCCAGATGTGCACTTTAAATATATTCAGGCAGCTTGCAAGACTGGGCAAATCAAAGAAGTAGAAAGAATCTGTAGAGAAAGCAACTGCTACGATCCTGAGCGAGTCAAGAATTTTCTTAAGGAAGCAAAACTAACAGATCAGCTACCACTTATCATTGTGTGTGATCGATTTGACTTTGTCCATGATTTGGTGCTCTATTTATATAGAAATAATCTTCAAAAGTATATAGAGATATATGTACAGAAGGTGAATCCAAGTCGACTTCCTGTAGTTATTGGAGGATTACTTGATGTTGACTGTTCTGAAGATGTCATAAAAAACTTGATTCTTGTTGTAAGAGGTCAATTCTCTACTGATGAGCTTGTTGCTGAGGTTGAAAAAAGAAACAGATTGAAACTGCTTCTGCCTTGGCTAGAGGCCAGAATTCATGAGGGCTGTGAGGAGCCTGCTACTCACAATGCCTTAGCCAAAATCTACATAGACAGTAATAACAACCCGGAGAGATTTCTTCGTGAAAATCCCTACTATGACAGTCGCGTTGTTGGAAAGTATTGTGAGAAGAGAGATCCACATCTGGCCTGTGTTGCTTATGAACGTGGCCAATGTGATCTGGAACTTATTAATGTTTGCAATGAGAATTCCCTCTTCAAAAGTCTTTCTCGCTACCTGGTACGTCGAAAGGATCCAGAATTGTGGGGCAGCGTGCTGCTGGAAAGCAATCCTTACAGGAGACCCCTAATTGACCAGGTTGTACAAACAGCTTTGTCTGAGACTCAGGACCCTGAAGAAGTGTCAGTAACTGTAAAGGCTTTCATGACTGCAGACCTTCCTAATGAACTCATTGAACTGCTGGAGAAAATTGTCCTTGATAACTCTGTATTCAGTGAACACAGGAATCTGCAAAACCTCCTTATCCTCACTGCAATTAAGGCTGACCGTACACGTGTTATGGAGTATATTAACCGCCTGGATAATTATGATGCCCCAGATATTGCCAATATCGCCATCAGCAATGAGCTGTTTGAAGAAGCATTTGCCATTTTCCGGAAATTTGATGTCAATACTTCAGCAGTTCAGGTCTTAATTGAGCATATTGGAAACTTGGATCGGGCATATGAGTTTGCTGAACGTTGCAATGAACCTGCGGTCTGGAGTCAACTTGCAAAAGCCCAGTTGCAGAAAGGAATGGTGAAAGAAGCCATTGATTCTTATATCAAAGCAGATGATCCTTCCTCCTACATGGAAGTTGTTCAGGCTGCCAATACTAGTGGAAACTGGGAAGAACTGGTGAAGTACTTGCAGATGGCCCGTAAGAAGGCTCGAGAGTCCTATGTGGAGACAGAACTGATATTCGCACTGGCTAAAACAAACCGCCTTGCAGAGTTAGAAGAATTTATCAATGGACCAAATAATGCTCATATCCAACAAGTTGGTGACCGTTGTTATGATGAAAAAATGTATGATGCTGCTAAGTTGTTGTACAATAATGTTTCCAATTTTGGACGTTTGGCATCTACCCTGGTTCACCTGGGTGAATATCAGGCAGCTGTTGATGGGGCTAGGAAAGCTAACAGTACTCGAACATGGAAAGAGGTCTGCTTCGCCTGTGTAGATGGGAAAGAATTCCGTCTTGCTCAGATGTGTGGACTTCATATTGTTGTACATGCAGATGAATTAGAAGAACTTATCAACTACTATCAGGATCGTGGCTATTTTGAAGAGCTGATCACCATGTTGGAAGCAGCACTGGGACTTGAGCGAGCTCACATGGGAATGTTTACTGAATTAGCTATTCTATACTCTAAATTTAAGCCTCAGAAAATGAGGGAGCACCTGGAGCTGTTCTGGTCTAGAGTGAATATTCCCAAGGTGCTAAGAGCTGCAGAACAAGCTCATCTTTGGGCAGAACTGGTGTTTTTGTATGACAAGTATGAAGAATATGATAATGCCATAATTACCATGATGAATCATCCAACTGATGCCTGGAAAGAAGGGCAATTCAAAGATATCATTACCAAGGTTGCCAATGTGGAACTATACTACAGAGCAATACAGTTCTACTTAGAATTCAAGCCTCTGTTGTTAAATGATTTGCTGATGGTGCTGTCTCCACGGTTGGATCACACTCGTGCAGTCAATTATTTCAGCAAGGTTAAACAGCTACCACTGGTGAAACCGTATTTGCGTTCAGTTCAGAACCATAACAACAAATCTGTGAATGAATCATTGAACAATCTTTTTATTACAGAAGAAGATTATCAGGCTCTGCGAACATCAATAGATGCTTATGACAACTTTGACAATATCTCGCTTGCTCAGCGTTTGGAAAAACATGAACTCATTGAGTTCAGGAGAATTGCTGCTTATCTCTTCAAAGGCAACAATCGCTGGAAACAGAGTGTAGAGCTGTGCAAGAAAGACAGCCTTTACAAGGATGCAATGCAGTATGCTTCTGAATCTAAAGATACTGAATTGGCTGAAGAACTCCTGCAGTGGTTTTTGCAGGAAGAAAAAAGAGAGTGCTTTGGAGCTTGTCTGTTTACCTGTTACGATCTTTTAAGGCCAGATGTCGTCCTAGAAACTGCATGGAGGCACAATATCATGGATTTTGCCATGCCCTATTTCATCCAGGTCATGAAGGAGTACTTGACAAAGGTGGATAAATTAGATGCTTCAGAATCACTGAGAAAAGAAGAAGAACAAGCTACAGAGACACAACCCATTGTTTATGGTCAGCCCCAGTTGATGCTGACAGCAGGACCCAGTGTTGCCGTCCCTCCCCAGGCACCTTTTGGTTATGGTTATACCGCACCACCGTATGGACAGCCACAGCCTGGCTTTGGGTACAGCATGTGAGATGAAGCGCTGATCCTGTAGTCACCTATTTTCGTACTGAAACATCGTCTTTACCCACTTCTCAGTTTATAATGGGGGAAAACAGGCAACGTGTTCTTGTAACCTTTATTTCATGAAGGACTTCTTTTTGTTTCTAACTATAAACTTGGATCACCTATGTTAAAACCTTATTTCACATTCCACATCATTTTAGAATTTATTTTCGAAGGGGAATAGTTTCAATGTTTTATTCACTTGGGCTTTTTTTCTTCCCCCTCTTTCTTTAAAGAACTGCTCAATATTCAATCTGTTGTGAAGAACCTGATTTGCACTCTGTAGTGTTTAAAGAAACAAAGAAACTCTAATATTGAATCTCTTAAATTTAGTGTATGTAAACAGCTTACAAATACGTATTGTCTAAATGCATTTAAATCTGTTTTATTCAAAGAAAAGCTAAAGCAAAAACACTGGCATATGACCATGCAAGACTGTCAGTGCCAACAAAGACAACACTAATCAGCACATCGTACACTGGATTGCAGTGCTTCCCAGATTATTGAAAAATGTTACAGACAACTTGCCTGATTTTTAAATGAGCGTAAAAGGCCCTCTAACCTATGCAGGTTTCCCCATTATGCATATAGAAAATGCTAGTATGTTTTGCTCACTTCATATGTAACAGGTGCCCTTATGTTGTGCTGTATCCTGTGCTTTTTCTGTGGGACCATTCCATTCAGGAGCAAAGAGCACCATGATTCCAATCTTGTGTGTGTTTACTAACCCTTCCCTGAGGTTTGTGTATGTTGGATATTGTGGTGTTTTAGATCACTGAGTGTACAGAAGAGAGAAATTCAAACAAAATATTGCTGTTCTTCAGTTTTGTTTGTGGAATTTGAAATTACTCAAATTTAAAATAAATTACTGGACTGTGGAAATAACATAGAATTGAAGTTTTAATTAAATACCACTCAAACGAAAAGAACAGTAGTTTTTGTAGTTTTATATTGGATACTGAGGCATTAGGGAGGCATGAAAGGAAGAGGAATGAGGATTGAGACATGTGAAGACATTGTGCATTATATCAATGTGCATTCCTGTAGTTCATTAACAAGGTACATGCAATAGTCTAAAGAACCAGAGTCACTACTATAGTGGCTTAACATTTAATCTGTCTCCAATATTTTAACCAAGTGACACCGAGGTTTTTATCGAAGCATTTCACTTAAATGAACAAATCATGGCTGTTATATTAACTTGAAATAAAATATATTTAAACATGTAGTTAACATGCTCTTTC