Transcript asmbl_62375

Sequence
Transcript Sequence for observation asmbl_62375 of TGE0059645:
CCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAAGCCAAAGCGAAGGCTTTAAAGGCCAAGAAGGCAGTGTTGAAAGGTGTCCACAGCCACAAAAAGAAGAAGATCCGCACGTCACCCACCTTCCGGCGGCCGAAGACACTGCGACTCCGGAGACAGCCCAAATATCCTCGGAAGAGCGCTCCCAGGAGAAACAAGCTTGACCACTATGCTATCATCAAGTTTCCGCTGACCACTGAGTCTGCCATGAAGAAGATAGAAGACAACAACACACTTGTGTTCATTGTGGATGTTAAAGCCAACAAGCACCAGATTAAACAGGCTGTGAAGAAGCTGTATGACATTGATGTGGCCAAGGTCAACACCCTGATTCGGCCTGATGGAGAGAAGAAGGCATATGTTCGACTGGCTCCTGATTACGATGCTTTGGATGTTGCCAACAAAATTGGGATCATCTAAACTGAGTCCAGCTGCCTAATTCTGAATATATATATATATATATCTTTTCACCATATACATGCCTGTCTGTCAATTTCTGGTTGGGCTGGGAGGCCACACACACACACTGACATGACAGGGCTTGGGCAAGACTCCTGTTCTACTTATCCTTTTGAAATACCTCACCCTGCCACTCCACCATGTATGATCATTCCAGAGATCTTTGTGACTAGAGTTAGTGTCCTAGGAAAACCAGAACTCAGAACTTGCCTCCATGGTTGAGTAACAAGCTGTACAAGAACCCCTTTTATCCCTGGAAGAGGCTGTGTATGAAACCAATGCCCAGGGTTTGAAGGGTGTTAGCATCCATTTCAGGGGAGTGTGGATTGGCTGGCTCTCTGGTAGCATTTTGTCCTCACACACCCATCTACTATGTCCAACCGGTCTGTCTGCTTCCCTCACCCCTTGCCCAATAAAGGACAAGGACTTCAGAGG