Transcript asmbl_62121

Sequence
Transcript Sequence for observation asmbl_62121 of TGE0059644:
GGTGCACTGTGGACGATGAGTCAGGGTTAGGGGCGCCAGGACGTGGGCGTGCAGGACGCCAGAGCTGGGTCAGAGCTCGAGCCAGCGGCGCCCGGAGAGATTCGGAGATGCAGGCGGCTCGGATGGCCGCGAGCTTGGGGCGGCAGCTGCTGAGGCTCGGGGGCGGAAGCTCGCGGCTCACGGCGCTCCTGGGGCAGCCCCGGCCCGGCCCTGCCCGGCGGCCCTATGCCGGGGGTGCCGCTCAGCTGGCTCTGGACAAGTCAGATTCCCACCCCTCTGACGCTCTGACCAGGAAAAAACCGGCCAAGGCGGAATCTAAGTCCTTTGCTGTGGGAATGTTCAAAGGCCAGCTCACCACAGATCAGGTGTTCCCATACCCGTCCGTGCTCAACGAAGAGCAGACACAGTTTCTTAAAGAGCTGGTGGAGCCTGTGTCCCGTTTCTTCGAGGAAGTGAACGATCCCGCCAAGAATGACGCTCTGGAGATGGTGGAGGAGACCACTTGGCAGGGCCTCAAGGAGCTGGGGGCCTTTGGTCTGCAAGTGCCCAGTGAGCTGGGTGGTGTGGGCCTTTGCAACACCCAGTACGCCCGTTTGGTGGAGATCGTGGGCATGCATGACCTTGGCGTGGGCATTACCCTGGGGGCCCATCAGAGCATCGGTTTCAAAGGCATCCTGCTCTTTGGCACAAAGGCCCAGAAAGAAAAATACCTCCCCAAGCTGGCATCTGGGGAGACTGTGGCCGCTTTCTGTCTAACCGAGCCCTCAAGCGGGTCAGATGCAGCCTCCATCCGAACCTCTGCTGTGCCCAGCCCCTGTGGAAAATACTATACCCTCAATGGAAGCAAGCTTTGGATCAGTAATGGGGGCCTAGCAGACATCTTCACGGTCTTTGCCAAGACACCAGTTACAGATCCAGCCACAGGAGCCGTGAAGGAGAAGATCACAGCTTTTGTGGTGGAGAGGGGCTTCGGGGGCATTACCCATGGGCCCCCTGAGAAGAAGATGGGCATCAAGGCTTCAAACACAGCAGAGGTGTTCTTTGATGGAGTACGGGTGCCATCGGAGAACGTGCTGGGTGAGGTTGGGAGTGGCTTCAAGGTTGCCATGCACATCCTCAACAATGGAAGGTTTGGCATGGCTGCGGCCCTGGCAGGTACCATGAGAGGCATCATTGCTAAGGCGGTAGATCATGCCACTAATCGTACCCAGTTTGGGGAGAAAATTCACAACTTTGGGCTGATCCAGGAGAAGCTGGCACGGATGGTTATGCTGCAGTATGTAACTGAGTCCATGGCTTACATGGTGAGTGCTAACATGGACCAGGGAGCCACGGACTTCCAGATAGAGGCCGCCATCAGCAAAATCTTTGGCTCGGAGGCAGCCTGGAAGGTGACAGATGAATGCATCCAAATCATGGGGGGTATGGGCTTCATGAAGGAACCTGGAGTAGAGCGTGTGCTCCGAGATCTTCGCATCTTCCGGATCTTTGAGGGGACAAATGACATTCTTCGGCTGTTTGTGGCTCTGCAGGGCTGTATGGTAAGACAGAGAATTGGGTGGGGGTAGAGGTGGGGAGGACAGTGAGTCCTGACTGCTGGACCCTCTTCCCCCATAGGACAAAGGAAAGGAGCTCTCTGGGCTTGGCAGTGCTCTAAAGAATCCCTTTGGGAATGCTGGCCTCCTGCTAGGAGAGGCAGGCAAACAGCTGAGGCGGCGGGCAGGGCTGGGCAGCGGCCTGAGTCTCAGCGGACTTGTCCACCCGGAGTTGAGTCGGAGTGGCGAGCTGGCAGTACGGGCTCTGGAGCAGTTTGCCACTGTGGTGGAGGCCAAGCTGATAAAACACAAGAAGGGGATTGTCAATGAACAGTTTCTGCTGCAGCGGCTGGCAGACGGGGCCATCGACCTCTATGCCATGGTGGTGGTTCTCTCGAGGGCCTCAAGATCCCTGAGTGAGGGCCACCCCACGGCCCAGCATGAGAAAATGCTCTGTGACACCTGGTGTATCGAGGCTGCAGCTCGGATCCGAGAGGGCATGGCCGCCCTGCAGTCTGACCCCTGGCAGCAAGAGCTCTACCGCAACTTCAAAAGCATCTCCAAGGCCTTGGTGGAGCGGGGTGGTGTGGTCACCAGCAACCCACTTGGCTTCTGAATACTCCCGGCCAGGGCCTGTCCCAGTTATGTGCCTTCCCTCAAGCCAAAGCCGAAGCCCCTTTCCTTAAGGCCCTGGTTTGTCCCGAAGGGGCCTAGTGTTCCCAGCACTGTGCCTGCTCTCAAGAGCACTTACTGCCTCGCAAATAATAAAAATTTCTAGCCAG