Transcript asmbl_62120

Sequence
Transcript Sequence for observation asmbl_62120 of TGE0059643:
AATCTAAGTCCTTTGCTGTGGGAATGTTCAAAGGCCAGCTCACCACAGATCAGGTGTTCCCATACCCGTCCGTGCTCAACGAAGAGCAGACACAGTTTCTTAAAGAGCTGGTGGAGCCTGTGTCCCGTTTCTTCGAGGAAGTGAACGATCCCGCCAAGAATGACGCTCTGGAGATGGTGGAGGAGACCACTTGGCAGGGCCTCAAGGAGCTGGGGGCCTTTGGTCTGCAAGTGCCCAGTGAGCTGGGTGGTGTGGGCCTTTGCAACACCCAGTACGCCCGTTTGGTGGAGATCGTGGGCATGCATGACCTTGGCGTGGGCATTACCCTGGGGGCCCATCAGAGCATCGGTTTCAAAGGCATCCTGCTCTTTGGCACAAAGGCCCAGAAAGAAAAATACCTCCCCAAGCTGGCATCTGGTGAGGCAACCCTAGGAGAGCCAGGGATTGGGGGGCACACTGGGCTTGGCACAGATTAGGCCAGTTGGCACTTAGATTATCAGATGGCTGAGCATTTCAGTTGGGGGAAGGTTTTGGGGAGGCATCACAGTGTGCTGGTTGGGACATGCAAAAGAACTGGATACTCCCAGGTGTTAAGGGGGAACTGCCTGCTGGAGGGATGGGGAAGTGGGCCGAGGGGACTTTGAAGCTCATCAGAACTTGGGGTAAAGTAGCTCTCTCCCCAACAGGGGAGACTGTGGCCGCTTTCTGTCTAACCGAGCCCTCAAGCGGGTCAGATGCAGCCTCCATCCGAACCTCTGCTGTGCCCAGCCCCTGTGGAAAATACTATACCCTCAATGGAAGCAAGCTTTGGATCAGTAATGGGGGCCTAGCAGACATCTTCACGGTCTTTGCCAAGACACCAGTTACAGATCCAGCCACAGGAGCCGTGAAGGAGAAGATCACAGCTTTTGTGGTGGAGAGGGGCTTCGGGGGCATTACCCATGGGCCCCCTGAGAAGAAGATGGGCATCAAGGCTTCAAACACAGCAGAGGTGTTCTTTGATGGAGTACGGGTGCCATCGGAGAACGTGCTGGGTGAGGTTGGGAGTGGCTTCAAGGTTGCCATGCACATCCTCAACAATGGAAGGTTTGGCATGGCTGCGGCCCTGGCAGGTACCATGAGAGGCATCATTGCTAAGGCGGTAGATCATGCCACTAATCGTACCCAGTTTGGGGAGAAAATTCACAACTTTGGGCTGATCCAGGAGAAGCTGGCACGGATGGTTATGCTGCAGTATGTAACTGAGTCCATGGCTTACATGGTGAGTGCTAACATGGACCAGGGAGCCACGGACTTCCAGATAGAGGCCGCCATCAGCAAAATCTTTGGCTCGGAGGCAGCCTGGAAGGTGACAGATGAATGCATCCAAATCATGGGGGGTATGGGCTTCATGAAGGAACCTGGAGTAGAGCGTGTGCTCCGAGATCTTCGCATCTTCCGGATCTTTGAGGGGACAAATGACATTCTTCGGCTGTTTGTGGCTCTGCAGGGCTGTATGGACAAAGGAAAGGAGCTCTCTGGGCTTGGCAGTGCTCTAAAGAATCCCTTTGGGAATGCTGGCCTCCTGCTAGGAGAGGCAGGCAAACAGCTGAGGCGGCGGGCAGGGCTGGGCAGCGGCCTGAGTCTCAGCGGACTTGTCCACCCGGAGTTGAGTCGGAGTGGCGAGCTGGCAGTACGGGCTCTGGAGCAGTTTGCCACTGTGGTGGAGGCCAAGCTGATAAAACACAAGAAGGGGATTGTCAATGAACAGTTTCTGCTGCAGCGGCTGGCAGACGGGGCCATCGACCTCTATGCCATGGTGGTGGTTCTCTCGAGGGCCTCAAGATCCCTGAGTGAGGGCCACCCCACGGCCCAGCATGAGAAAATGCTCTGTGACACCTGGTGTATCGAGGCTGCAGCTCGGATCCGAGAGGGCATGGCCGCCCTGCAGTCTGACCCCTGGCAGCAAGAGCTCTACCGCAACTTCAAAAGCATCTCCAAGGCCTTGGTGGAGCGGGGTGGTGTGGTCACCAGCAACCCACTTGGCTTCTGAATACTCCCGGCCAGGGCCTGTCCCAGTTATGTGCCTTCCCTCAAGCCAAAGCCGAAGCCCCTTTCCTTAAGGCCCTGGTTTGTCCCGAAGGGGCCTAGTGTTCCCAGCACTGTGCCTGCTCTCAAGAGCACTTACTGCCTCGCAAATAATAAAAATTTCTAGCCAG