Transcript asmbl_61987

Sequence
Transcript Sequence for observation asmbl_61987 of TGE0058202:
GCTGTAATCTGAAGCCTGCTGGACGCTGGATTAGAAGGCAGCAAAAAAAGCTCTGTGCTGGCTGGAGCCCCCTCAGTGTGCAGGCTTAGAGGGACTAGGCTGGGTGTGGAGCTGCAGCGTATCCACAGGCCCCAGGATGCAGGCCCTGGTGCTACTCCTCTGCATTGGAGCCCTCCTCGGGCACAGCAGCTGCCAGAACCCTGCCAGCCCCCCGGAGGAGGGCTCCCCAGACCCCGACAGCACAGGGGCGCTGGTGGAGGAGGAGGATCCTTTCTTCAAAGTCCCCGTGAACAAGCTGGCAGCGGCTGTCTCCAACTTCGGCTATGACCTGTACCGGGTGCGATCCAGCACGAGCCCCACGACCAACGTGCTCCTGTCTCCTCTCAGTGTGGCCACGGCCCTCTCGGCCCTCTCGCTGGGAGCGGAGCAGCGAACAGAATCCATCATTCACCGGGCTCTCTACTATGACTTGATCAGCAGCCCAGACATCCATGGTACCTATAAGGAGCTCCTTGACACGGTCACTGCCCCCCAGAAGAACCTCAAGAGTGCCTCCCGGATCGTCTTTGAGAAGAAGCTGCGCATAAAATCCAGCTTTGTGGCACCTCTGGAAAAGTCATATGGGACCAGGCCCAGAGTCCTGACGGGCAACCCTCGCTTGGACCTGCAAGAGATCAACAACTGGGTGCAGGCGCAGATGAAAGGGAAGCTCGCCAGGTCCACAAAGGAAATTCCCGATGAGATCAGCATTCTCCTTCTCGGTGTGGCGCACTTCAAGGGGCAGTGGGTAACAAAGTTTGACTCCAGAAAGACTTCCCTCGAGGATTTCTACTTGGATGAAGAGAGGACCGTGAGGGTCCCCATGATGTCGGACCCTAAGGCTGTTTTACGCTATGGCTTGGATTCAGATCTCAGCTGCAAGATTGCCCAGCTGCCCTTGACCGGAAGCATGAGTATCATCTTCTTCCTGCCCCTGAAAGTGACCCAGAATTTGACCTTGATAGAGGAGAGCCTCACCTCCGAGTTCATTCATGACATAGACCGAGAACTGAAGACCGTGCAGGCGGTCCTCACTGTCCCCAAGCTGAAGCTGAGTTATGAAGGCGAAGTCACCAAGTCCCTGCAGGAGATGAAGCTGCAATCCTTGTTTGATTCACCAGACTTTAGCAAGATCACAGGCAAACCCATCAAGCTGACTCAGGTGGAACACCGGGCTGGCTTTGAGTGGAACGAGGATGGGGCGGGAACCACCCCCAGCCCAGGGCTGCAGCCTGCCCACCTCACCTTCCCGCTGGACTATCACCTTAACCAGCCTTTCATCTTCGTACTGAGGGACACAGACACAGGGGCCCTTCTCTTCATTGGCAAGATTCTGGACCCCAGGGGCCCCTAATATCCCAGTTTAATATTCCAATACCCTAGAAGAAAACCCGAGGGACAGCAGATTCCACAGGACACGAAGGCTGCCCCTGTAAGGTTTCAATGCATACAATAAAAGAGCTTTATCCCTA