Transcript asmbl_56616

Sequence
Transcript Sequence for observation asmbl_56616 of TGE0058015:
ATAAAGAGAGGCGTCCGAGACGCGCAGGGAGATTTGGACGCTCCGGCCTGGGAGGTGCGTCAGATCCGAGCTCGCCATCCAGTTTCCTCTCCACTAGTCCCCCCAGTTGGAGATCTGGGACCAACAAGGCACCATGGCGCAGAAGGGCCAACTCAGTGACGATGAGAAGTTCCTCTTTGTGGACAAAAACTTCATCAACAGCCCAGTGGCCCAGGCTGACTGGGCCGCCAAGAGACTCGTCTGGGTCCCCTCGGAGAAGCAGGGCTTCGAGGCAGCCAGCATTAAGGAGGAGAAGGGGGATGAGGTGGTTGTGGAGCTGGTGGAGAATGGCAAGAAGGTCACGGTTGGGAAAGATGACATCCAGAAGATGAACCCACCCAAGTTCTCCAAGGTGGAGGACATGGCGGAGCTGACGTGCCTCAACGAAGCCTCCGTGCTACACAACCTGAGGGAGCGGTACTTCTCAGGGCTAATATATACGTACTCTGGCCTCTTCTGCGTGGTGGTCAACCCCTATAAACACCTGCCCATCTACTCGGAGAAGATCGTCGACATGTACAAGGGCAAGAAGAGGCACGAGATGCCGCCTCACATCTACGCCATCGCAGACACGGCCTACCGGAGCATGCTTCAAGATCGGGAGGACCAGTCCATTCTATGCACAGGCGAGTCTGGAGCCGGGAAAACCGAAAACACCAAGAAGGTCATTCAGTACCTGGCCGTGGTGGCCTCCTCCCACAAGGGCAAGAAAGACACAAGTATCACGGGAGAGCTGGAAAAGCAGCTTCTACAAGCAAACCCGATTCTGGAGGCTTTCGGCAACGCCAAAACAGTGAAGAACGACAACTCCTCACGATTCGGCAAATTCATCCGCATCAACTTCGACGTCACGGGTTACATCGTGGGAGCCAACATTGAGACCTATCTGCTAGAAAAATCACGGGCAATTCGCCAAGCCAGAGACGAGAGGACATTCCACATCTTTTACTACATGATTGCTGGAGCCAAGGAGAAGATGAGAAGTGACTTGCTTTTGGAGGGCTTCAACAACTACACCTTCCTCTCCAATGGCTTTGTGCCCATCCCAGCAGCCCAGGATGATGAGATGTTCCAGGAAACCGTGGAGGCCATGGCAATCATGGGTTTCAGCGAGGAGGAGCAGCTATCCATATTGAAGGTGGTATCATCGGTCCTGCAGCTTGGAAATATCGTCTTCAAGAAGGAAAGAAACACAGACCAGGCGTCCATGCCAGATAACACAGCTGCTCAGAAAGTTTGCCACCTCATGGGAATTAATGTGACAGATTTCACCAGATCCATCCTCACTCCTCGTATCAAGGTTGGGCGAGATGTGGTACAGAAAGCTCAGACAAAAGAACAGGCTGACTTTGCTGTAGAGGCTTTGGCCAAGGCAACATATGAGCGCCTTTTCCGCTGGATACTCACCCGCGTGAACAAAGCCCTGGACAAGACCCATCGGCAAGGGGCTTCCTTCCTGGGGATCCTGGATATAGCTGGATTTGAGATCTTTGAGGTGAACTCCTTCGAGCAGCTGTGCATCAACTACACCAACGAGAAGCTGCAGCAGCTCTT