Transcript asmbl_56615

Sequence
Transcript Sequence for observation asmbl_56615 of TGE0058017:
GAGCGCAGCACGGCCCAGAAGAATGAGAGTGCCCGGCAGCAGCTCGAGCGGCAGAACAAGGAGCTCCGGAGCAAGCTCCACGAGATGGAGGGGGCCGTCAAGTCCAAGTTCAAGTCCACCATCGCGGCGCTGGAGGCCAAGATTGCACAGCTGGAGGAGCAGGTCGAGCAGGAGGCCAGAGAGAAACAGGCGGCCACCAAGTCGCTGAAGCAGAAAGACAAGAAGCTGAAGGAAATCTTGCTGCAGGTGGAGGACGAGCGCAAGATGGCCGAGCAGTACAAGGAGCAGGCAGAGAAAGGCAATGCCAGGGTCAAGCAGCTCAAGAGGCAGCTGGAGGAGGCAGAGGAGGAGTCCCAGCGCATCAACGCCAACCGCAGGAAGCTGCAGCGGGAGCTGGATGAGGCCACGGAGAGCAACGAGGCCATGGGCCGCGAGGTGAACGCACTCAAGAGCAAGCTCAGAGGGCCCCCCCCACAGGAAACTTCGCAGTGATGCACCAGGCGAGGAAACGAGACCTCTTTCGTTCCTTCTAGAAGGTCTGGAGGACGTAGAGTTATTGAAAATGCAGATGGTTCTGAGGAGGAAACGGACACTCGAGACGCAGACTTCAATGGAACCAAGGCCAGTGAATAAGCAACTTTCTACAGTTTTGCACCACGGCAAGAAAACCAAAAACCAAAACAAACAAACAAAAAAAACCCAACAACAACCCAGAACAAAGCAAAACCCAGCAGACTGTACTTAGCATTGTCTAAATCCATTCTCAAATTCCAAATATCACAGACACCCCTCACACAAGGAATATAAAAACCACCACCCTCCAGCCTGGGCAACGTAGTAAAACCTCATCTATACAAGAATTTAAAAATAAGCTGGGCGTGGTGGTACACACCTGTGGTCCCAGCTACTAGGGAGGCTGAGCCAGGAAGAACGCTCCAGCCCAGGACTTCGAGGCTGCAATGAGCTATAATTGCATCATTGCACTCCAGCCTGGGCAACAGAGACCCTGTCTCAACCACCACCACCACCACCACCCCTACTACCCCTGTATTCAAGGTAAAAATTGAAGTTTGTATGATGTAAGAGATGAGAAAAACCCAACAGGAAACACAGACACATCCTCCAGTTCTATCAATGGATTGTGCAGACACTGAGTTTTTAGAAAAACATATCCACGGTAACCGGTCCCTGGCAATTCTGTTTACATGAAATGGGGAGAAAGTCACCGAAATGGGTGCCGCCGGCCCCCACTCCCAATTCATTCCCTAACCTGCAAACCTTTCCAACTTCTCACGTCAGGCCTTTGAGAATTCTTTCCCCCTCTCCTGGTTTCCACACCTCAGACACGCACAGTTCACCAAGTGCCTTCTGTAGTCACATGAATTGAAAAGGAGACGCTGCTCCCACGGAGGGGAGCAGGAATGCTGCACTGTTTACACCCTGACTGTGCTTAAAAACACTTTCACTAATAAATGGTTAT