Transcript asmbl_56613

Sequence
Transcript Sequence for observation asmbl_56613 of TGE0056242:
ACGAGAAGCTGCAGCAGCTCTTCAACCACACCATGTTCATCCTGGAGCAGGAGGAGTACCAGCGCGAGGGCATCGAGTGGAACTTCATCGACTTTGGGCTGGACCTACAGCCCTGCATCGAGCTCATCGAGCGACCGAACAACCCTCCAGGTGTGCTGGCCCTGCTGGACGAGGAATGCTGGTTCCCCAAAGCCACGGACAAGTCTTTCGTGGAGAAGCTGTGCACGGAGCAGGGCAGCCACCCCAAGTTCCAGAAGCCCAAGCAGCTCAAGGACAAGACTGAGTTCTCCATCATCCATTATGCTGGGAAGGTGGACTATAATGCGAGTGCCTGGCTGACCAAGAATATGGACCCGCTGAATGACAACGTGACTTCCCTGCTCAATGCCTCCTCCGACAAGTTTGTGGCCGACCTGTGGAAGGACGTGGACCGCATCGTGGGCCTGGACCAGATGGCCAAGATGACGGAGAGCTCGCTGCCCAGCGCCTCCAAGACCAAGAAGGGCATGTTCCGCACAGTGGGGCAGCTGTACAAGGAGCAGCTGGGCAAGCTGATGACCACGCTACGCAACACCACGCCCAACTTCGTGCGCTGCATCATCCCCAACCACGAGAAGAGGTCCGGCAAGCTGGATGCGTTCCTGGTGCTGGAGCAGCTGCGGTGCAATGGGGTGCTGGAAGGCATTCGCATCTGCCGGCAGGGCTTCCCCAACCGGATCGTCTTCCAGGAGTTCCGCCAACGCTACGAGATCCTGGCGGCGAATGCCATCCCCAAAGGCTTCATGGACGGGAAGCAGGCCTGCATTCTCATGATCAAAGCCCTGGAACTTGACCCCAACTTATACAGGATAGGGCAGAGCAAAATCTTCTTCCGAACTGGCGTCCTGGCCCACCTAGAGGAGGAGCGAGATTTGAAGATCACCGATGTCATCATGGCCTTCCAGGCGATGTGTCGTGGCTACTTGGCCAGAAAGGCTTTTGCCAAGAGGCAGCAGCAGCTGACCGCCATGAAGGTGATTCAGAGGAACTGCGCCGCCTACCTCAAGCTGCGGAACTGGCAGTGGTGGAGGCTTTTCACCAAAGTGAAGCCACTGCTGCAGGTGACACGGCAGGAGGAGGAGATGCAGGCCAAGGAGGATGAACTGCAGAAGACCAAGGAGCGGCAGCAGAAGGCAGAGAATGAGCTTAAGGAGCTGGAACAGAAGCACTCGCAGCTGACCGAGGAGAAGAACCTGCTACAGGAACAGCTGCAGGCAGAGACAGAGCTGTATGCAGAGGCTGAGGAGATGCGGGTGCGGCTGGCGGCCAAGAAGCAGGAGCTGGAGGAGATACTGCATGAGATGGAGGCCCGCCTGGAGGAGGAGGAAGACAGGGGCCAGCAGCTACAGGCTGAAAGGAAGAAGATGGCCCAGCAGATGCTGGACCTTGAAGAACAGCTGGAGGAGGAGGAAGCTGCCAGGCAGAAGCTGCAACTTGAGAAGGTCACGGCTGAGGCCAAGATCAAGAAACTGGAGGATGAGATCCTGGTCATGGATGATCAGAACAATAAACTATCAAAAGAACGAAAACTCCTTGAGGAGAGGATTAGTGACTTAACGACAAATCTTGCAGAAGAGGAAGAAAAGGCCAAGAATCTTACCAAGCTGAAAAACAAGCATGAATCTATGATTTCAGAACTGGAAGTGCGGCTAAAGAAGGAAGAGAAGAGCCGACAGGAGCTGGAGAAGCTGAAACGGAAGCTGGAGGGTGATGCCAGCGACTTCCACGAGCAGATCGCTGACCTCCAGGCGCAGATCGCAGAGCTCAAGATGCAGCTGGCCAAGAAGGAGGAGGAGCTGCAGGCGGCCCTGGCCAGGCTTGACGATGAAATCGCTCAGAAGAACAATGCCCTGAAGAAGATCCGGGAGCTGGAGGGCCACATCTCAGACCTCCAGGAGGACCTGGACTCAGAGCGGGCCGCCAGGAACAAGGCTGAAAAGCAGAAGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGACACACTGGACAGCACAGCCACTCAGCAGGAGCTCAGGGCCAAGAGGGAGCAGGAGGTGACGGTGCTGAAGAAGGCCCTGGATGAAGAGACGCGGTCCCATGAGGCTCAGGTCCAGGAGATGAGGCAGAAACACGCACAGGCGGTGGAGGAGCTCACAGAGCAGCTTGAGCAGTTCAAGAGGGCCAAGGCGAACCTAGACAAGAATAAGCAGACGCTGGAGAAAGAGAACGCAGACCTGGCCGGGGAGCTGCGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGCAGTCCAAGTGCAGCGATGGGGAGCGGGCCCGGGCGGAGCTCAATGACAAAGTCCACAAGCTGCAGAATGAAGTTGAGAGCGTCACAGGGATGCTTAACGAGGCCGAGGGGAAGGCCATTAAGCTGGCCAAGGACGTGGCGTCCCTCAGTTCCCAGCTCCAGGACACCCAGGAGCTGCTTCAAGAAGAAACCCGGCAGAAGCTCAACGTGTCTACGAAGCTGCGCCAGCTGGAGGAGGAGCGGAACAGCCTGCAAGACCAGCTGGACGAGGAGATGGAGGCCAAGCAGAACCTGGAGCGCCACATCTCCACTCTCAACATCCAGCTCTCCGACTCGAAGAAGAAGCTGCAGGACTTTGCCAGCACCGTGGAAGCTCTGGAAGAGGGGAAGAAGAGGTTCCAGAAGGAGATCGAGAACCTCACCCAGCAGTACGAGGAGAAGGCGGCCGCTTATGATAAACTGGAAAAGACCAAGAACAGGCTTCAGCAGGAGCTGGACGACCTGGTTGTTGATTTGGACAACCAGCGGCAACTCGTGTCCAACCTGGAAAAGAAGCAGAGGAAATTTGATCAGTTGTTAGCCGAGGAGAAAAACATCTCTTCCAAATACGCGGATGAGAGGGACAGAGCTGAGGCAGAAGCCAGGGAGAAGGAAACCAAGGCCCTGTCCCTGGCTCGGGCCCTTGAAGAGGCCTTGGAAGCCAAAGAGGAACTCGAGCGGACCAACAAAATGCTCAAAGCCGAAATGGAAGACCTGGTCAGCTCCAAGGATGACGTGGGCAAGAACGTCCATGAGCTGGAGAAGTCCAAGCGGGCCCTGGAGACCCAGATGGAGGAGATGAAGACGCAGCTGGAAGAGCTGGAGGACGAGCTGCAAGCCACGGAGGACGCCAAACTGCGGCTGGAAGTCAACATGCAGGCGCTCAAGGGCCAGTTCGAAAGGGATCTCCAAGCCCGGGACGAGCAGAATGAGGAGAAGAGGAGGCAACTGCAGAGACAGCTTCACGAGTATGAGACGGAACTGGAAGACGAGCGAAAGCAACGTGCCCTGGCAGCTGCAGCAAAGAAGAAGCTGGAAGGGGACCTGAAAGACCTGGAGCTTCAGGCCGACTCTGCCATCAAGGGGAGGGAGGAAGCCATCAAGCAGCTACGCAAACTGCAGGCTCAGATGAAGGACTTTCAAAGAGAGCTGGAAGATGCCCGTGCCTCCAGAGATGAGATCTTTGCCACAGCCAAAGAGAATGAGAAGAAAGCCAAGAGCTTGGAAGCAGACCTCATGCAGCTACAAGAGGACCTCGCCGCCGCTGAGAGGGCTCGCAAACAAGCGGACCTCGAGAAGGAGGAACTGGCAGAGGAGCTGGCCAGTAGCCTGTCGGGAAGGAACGCACTCCAGGACGAGAAGCGCCGCCTGGAGGCCCGGATCGCCCAGCTGGAGGAGGAGCTGGAGGAGGAGCAGGGCAACATGGAGGCCATGAGCGACCGGGTCCGCAAAGCCACACAGCAGGCCGAGCAGCTCAGCAACGAGCTGGCCACAGAGCGCAGCACGGCCCAGAAGAATGAGAGTGCCCGGCAGCAGCTCGAGCGGCAGAACAAGGAGCTCCGGAGCAAGCTCCACGAGATGGAGGGGGCCGTCAAGTCCAAGTTCAAGTCCACCATCGCGGCGCTGGAGGCCAAGATTGCACAGCTGGAGGAGCAGGTCGAGCAGGAGGCCAGAGAGAAACAGGCGGCCACCAAGTCGCTGAAGCAGAAAGACAAGAAGCTGAAGGAAATCTTGCTGCAGGTGGAGGACGAGCGCAAGATGGCCGAGCAGTACAAGGAGCAGGCAGAGAAAGGCAATGCCAGGGTCAAGCAGCTCAAGAGGCAGCTGGAGGAGGCAGAGGAGGAGTCCCAGCGCATCAACGCCAACCGCAGGAAGCTGCAGCGGGAGCTGGATGAGGCCACGGAGAGCAACGAGGCCATGGGCCGCGAGGTGAACGCACTCAAGAGCAAGCTCAGGCGAGGAAACGAGACCTCTTTCGTTCCTTCTAGAAGGTCTGGAGGACGTAGAGTTATTGAAAATGCAGATGGTTCTGAGGAGGAAACGGACACTCGAGACGCAGACTTCAATGGAACCAAGGCCAGTGAATAAGCAACTTTCTACAGTTTTGCACCACGGCAAGAAAACCAAAAACCAAAACAAACAAACAAAAAAAACCCAACAACAACCCAGAACAAAGCAAAACCCAGCAGACTGTACTTAGCATTGTCTAAATCCATTCTCAAATTCCAAATATCACAGACACCCCTCACACAAGGAATATAAAAACCACCACCCTCCAGCCTGGGCAACGTAGTAAAACCTCATCTATACAAGAATTTAAAAATAAGCTGGGCGTGGTGGTACACACCTGTGGTCCCAGCTACTAGGGAGGCTGAGGCAGGAGAAT