Transcript asmbl_55926

Sequence
Transcript Sequence for observation asmbl_55926 of TGE0056243:
GGAAAACCTCTCCATCATACTCCGCCCTCGAGACACCAGCCCCCTCCATGACGTCTTCAGCCGCGCGCCCGACGTCGGCTGAGACGGCCATAGACACTGGCGGCTAGAGGGGCCCGGACTTGCCCTCCCAGCTCTAACTTCCGCCGGAAGTGCCTTCCAGCCGCAGGCGCCCTTCTTCTTCTGTGCGCTCGGGCTCCTGGTCCCGGCTCCCCGGTTACCGGGGCGCGAGTATGACCACAATGGCGGCCGCCACCCTGCTGCGCGCGACGCCCCACTTCAGCGGTCTCGCCGCCGGCCGGACCTTCCTGCTGCAGGGTCTGTTGCGGCTGCTGAAAGCCCCGGCATTGCCTCTCTTGTGCCGCGGCCTGGCCGTGGAGGCCAAGAAGACTTACGTGCGCGACAAGCCACATGTGAATGTGGGTACCATCGGCCATGTGGACCACGGGAAGACCACGCTGACTGCAGCCATCACGAAGATTCTAGCTGAGGGAGGTGGGGCTAAGTTCAAGAAGTACGAGGAGATTGACAATGCCCCGGAGGAGCGAGCTCGGGGTATCACCATCAATGCGGCTCATGTGGAGTATAGCACTGCCGCCCGCCACTACGCCCACACAGACTGCCCGGGTCATGCAGATTATGTTAAGAATATGATCACAGGCACTGCACCCCTCGACGGCTGCATCCTGGTGGTAGCAGCCAATGACGGCCCCATGCCCCAGACCCGAGAGCACTTATTACTGGCCAGACAGATTGGGGTGGAGCATGTGGTGGTGTATGTGAACAAGGCTGACGCTGTCCAGGACTCTGAGATGGTGGAACTGGTGGAACTGGAGATCCGGGAGCTGCTCACCGAGTTTGGCTATAAAGGGGAGGAGACCCCAGTCATCGTAGGCTCTGCTCTCTGTGCCCTTGAGGTGAACGCGGGGTCAGGCAGGGCAGCTGCTGCAGAGGGTGGGGCTGGATGGGCACCCAGAGCTCTGCTTTGTGTCTGGGAAGTGGCTCTTGATAATCGAGGGAAGTAGAATGGGGATTTCAGAGTCCTGGCACTTCCCCTCAACAGGGTCGGGACCCTGAGTTAGGCCTGAAGTCTGTGCAGAAGCTACTGGATGCTGTGGACACTTACATCCCAGTGCCCGCCCGGGACCTGGAGAAGCCTTTCCTGCTGCCTGTGGAGGCGGTGTACTCCGTCCCTGGCCGTGGCACCGTGGTGACAGGTACACTAGAGCGTGGCATTTTAAAGAAGGGAGACGAGTGTGAGCTCCTAGGACATAGCAAGAACATCCGCACTGTGGTGACAGGTTTGGGAAGCCAGTCTGGAGAGCAGGGCCTGGCTGAAGGGTGGCCTTACCCCGGCAGATCCCTTGTGCCTTCCCTCTGTCTCACATTCGCCTTCCTTCTCCCTGCTCCTTTTCCCTTTCCGTCCTAGGCATTGAGATGTTCCACAAGAGCCTGGAGAGGGCCGAGGCCGGAGATAACCTCGGGGCCCTGGTCCGAGGCTTGAAGCGGGAGGACTTGCGGCGGGGCCTGGTCATGGTCAAGCCAGGTTCCATCAAGCCCCACCAGAAGGTGGAGGCCCAGGTTTACATCCTCAGCAAGGAGGAAGGTGGCCGCCACAAGCCCTTTGTGTCCCACTTCATGCCTGTCATGTTCTCCCTGACTTGGGACATGGCCTGTCGGATTATCCTGCCCCCAGAGAAGGAGCTTGCCATGCCCGGGGAGGACCTGAAGTTCAACCTAATCTTGCGGCAGCCAATGATCTTAGAGAAAGGCCAGCGTTTCACCCTGCGAGATGGCAACCGGACTATTGGCACCGGTCTAGTCACCAACACGCTGGCCATGACTGAGGAGGAGAAGAATATCAAATGGGGTTGAGTGTGCAGATCTCTGCTCAGCTTCCCTTGCGTTTAAGGCCTGCCCTAGCCAGGGCTCCCTCCTGCTTCCAGTACCCTCTCATGGCATAGGCTGCAACCCAGCAGAGGGCAGCTAGATGGACATTTCCCCTGCTCGGAAGGGTTGGCCTGCCTGGCTGGGGAGGTCAGTAAACTTTGAATAGTAAGCCAGCCTGTGTCCTGTGTCCTTTGTGCAAATTGGAGAGGATAGGGGAGGACAAAAAGGGTGTTGAACCCCAGACAGATGGGGAGCTTGTGAGATCCCAGAGCAGTTTTAACGGATAAATCAAGTCCAGTGAGCTTAGTGATTGCCTAGACACAGTAGGATGCCGTTATTCAGCCTCCTGGGAGATAGTGGGAAAGAATGTTCTATCGCTCTGGAGCCAGCATGGCTTCAGCTCAGGTGCCAAACCC