Transcript asmbl_55839

Sequence
Transcript Sequence for observation asmbl_55839 of TGE0056242:
ACGAGAAGCTGCAGCAGCTCTTCAACCACACCATGTTCATCCTGGAGCAGGAGGAGTACCAGCGCGAGGGCATCGAGTGGAACTTCATCGACTTTGGGCTGGACCTACAGCCCTGCATCGAGCTCATCGAGCGACCGAACAACCCTCCAGGTGTGCTGGCCCTGCTGGACGAGGAATGCTGGTTCCCCAAAGCCACGGACAAGTCTTTCGTGGAGAAGCTGTGCACGGAGCAGGGCAGCCACCCCAAGTTCCAGAAGCCCAAGCAGCTCAAGGACAAGACTGAGTTCTCCATCATCCATTATGCTGGGAAGGTGGACTATAATGCGAGTGCCTGGCTGACCAAGAATATGGACCCGCTGAATGACAACGTGACTTCCCTGCTCAATGCCTCCTCCGACAAGTTTGTGGCCGACCTGTGGAAGGACGTGGACCGCATCGTGGGCCTGGACCAGATGGCCAAGATGACGGAGAGCTCGCTGCCCAGCGCCTCCAAGACCAAGAAGGGCATGTTCCGCACAGTGGGGCAGCTGTACAAGGAGCAGCTGGGCAAGCTGATGACCACGCTACGCAACACCACGCCCAACTTCGTGCGCTGCATCATCCCCAACCACGAGAAGAGGTCCGGCAAGCTGGATGCGTTCCTGGTGCTGGAGCAGCTGCGGTGCAATGGGGTGCTGGAAGGCATTCGCATCTGCCGGCAGGGCTTCCCCAACCGGATCGTCTTCCAGGAGTTCCGCCAACGCTACGAGATCCTGGCGGCGAATGCCATCCCCAAAGGCTTCATGGACGGGAAGCAGGCCTGCATTCTCATGATCAAAGCCCTGGAACTTGACCCCAACTTATACAGGATAGGGCAGAGCAAAATCTTCTTCCGAACTGGCGTCCTGGCCCACCTAGAGGAGGAGCGAGATTTGAAGATCACCGATGTCATCATGGCCTTCCAGGCGATGTGTCGTGGCTACTTGGCCAGAAAGGCTTTTGCCAAGAGGCAGCAGCAGCTGACCGCCATGAAGGTGATTCAGAGGAACTGCGCCGCCTACCTCAAGCTGCGGAACTGGCAGTGGTGGAGGCTTTTCACCAAAGTGAAGCCACTGCTGCAGGTGACACGGCAGGAGGAGGAGATGCAGGCCAAGGAGGATGAACTGCAGAAGACCAAGGAGCGGCAGCAGAAGGCAGAGAATGAGCTTAAGGAGCTGGAACAGAAGCACTCGCAGCTGACCGAGGAGAAGAACCTGCTACAGGAACAGCTGCAGGCAGAGACAGAGCTGTATGCAGAGGCTGAGGAGATGCGGGTGCGGCTGGCGGCCAAGAAGCAGGAGCTGGAGGAGATACTGCATGAGATGGAGGCCCGCCTGGAGGAGGAGGAAGACAGGGGCCAGCAGCTACAGGCTGAAAGGAAGAAGATGGCCCAGCAGATGCTGGACCTTGAAGAACAGCTGGAGGAGGAGGAAGCTGCCAGGCAGAAGCTGCAACTTGAGAAGGTCACGGCTGAGGCCAAGATCAAGAAACTGGAGGATGAGATCCTGGTCATGGATGATCAGAACAATAAACTATCAAAAGAACGAAAACTCCTTGAGGAGAGGATTAGTGACTTAACGACAAATCTTGCAGAAGAGGAAGAAAAGGCCAAGAATCTTACCAAGCTGAAAAACAAGCATGAATCTATGATTTCAGAACTGGAAGTGCGGCTAAAGAAGGAAGAGAAGAGCCGACAGGAGCTGGAGAAGCTGAAACGGAAGCTGGAGGGTGATGCCAGCGACTTCCACGAGCAGATCGCTGACCTCCAGGCGCAGATCGCAGAGCTCAAGATGCAGCTGGCCAAGAAGGAGGAGGAGCTGCAGGCGGCCCTGGCCAGGCTTGACGATGAAATCGCTCAGAAGAACAATGCCCTGAAGAAGATCCGGGAGCTGGAGGGCCACATCTCAGACCTCCAGGAGGACCTGGACTCAGAGCGGGCCGCCAGGAACAAGGCTGAAAAGCAGAAGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGACACACTGGACAGCACAGCCACTCAGCAGGAGCTCAGGGCCAAGAGGGAGCAGGAGGTGACGGTGCTGAAGAAGGCCCTGGATGAAGAGACGCGGTCCCATGAGGCTCAGGTCCAGGAGATGAGGCAGAAACACGCACAGGCGGTGGAGGAGCTCACAGAGCAGCTTGAGCAGTTCAAGAGGGCCAAGGCGAACCTAGACAAGAATAAGCAGACGCTGGAGAAAGAGAACGCAGACCTGGCCGGGGAGCTGCGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGCAGTCCAAGTGCAGCGATGGGGAGCGGGCCCGGGCGGAGCTCAATGACAAAGTCCACAAGCTGCAGAATGAAGTTGAGAGCGTCACAGGGATGCTTAACGAGGCCGAGGGGAAGGCCATTAAGCTGGCCAAGGACGTGGCGTCCCTCAGTTCCCAGCTCCAGGACACCCAGGAGCTGCTTCAAGAAGAAACCCGGCAGAAGCTCAACGTGTCTACGAAGCTGCGCCAGCTGGAGGAGGAGCGGAACAGCCTGCAAGACCAGCTGGACGAGGAGATGGAGGCCAAGCAGAACCTGGAGCGCCACATCTCCACTCTCAACATCCAGCTCTCCGACTCGAAGAAGAAGCTGCAGGACTTTGCCAGCACCGTGGAAGCTCTGGAAGAGGGGAAGAAGAGGTTCCAGAAGGAGATCGAGAACCTCACCCAGCAGTACGAGGAGAAGGCGGCCGCTTATGATAAACTGGAAAAGACCAAGAACAGGCTTCAGCAGGAGCTGGACGACCTGGTTGTTGATTTGGACAACCAGCGGCAACTCGTGTCCAACCTGGAAAAGAAGCAGAGGAAATTTGATCAGTTGTTAGCCGAGGAGAAAAACATCTCTTCCAAATACGCGGATGAGAGGGACAGAGCTGAGGCAGAAGCCAGGGAGAAGGAAACCAAGGCCCTGTCCCTGGCTCGGGCCCTTGAAGAGGCCTTGGAAGCCAAAGAGGAACTCGAGCGGACCAACAAAATGCTCAAAGCCGAAATGGAAGACCTGGTCAGCTCCAAGGATGACGTGGGCAAGAACGTCCATGAGCTGGAGAAGTCCAAGCGGGCCCTGGAGACCCAGATGGAGGAGATGAAGACGCAGCTGGAAGAGCTGGAGGACGAGCTGCAAGCCACGGAGGACGCCAAACTGCGGCTGGAAGTCAACATGCAGGCGCTCAAGGGCCAGTTCGAAAGGGATCTCCAAGCCCGGGACGAGCAGAATGAGGAGAAGAGGAGGCAACTGCAGAGACAGCTTCACGAGTATGAGACGGAACTGGAAGACGAGCGAAAGCAACGTGCCCTGGCAGCTGCAGCAAAGAAGAAGCTGGAAGGGGACCTGAAAGACCTGGAGCTTCAGGCCGACTCTGCCATCAAGGGGAGGGAGGAAGCCATCAAGCAGCTACGCAAACTGCAGGCTCAGATGAAGGACTTTCAAAGAGAGCTGGAAGATGCCCGTGCCTCCAGAGATGAGATCTTTGCCACAGCCAAAGAGAATGAGAAGAAAGCCAAGAGCTTGGAAGCAGACCTCATGCAGCTACAAGAGGACCTCGCCGCCGCTGAGAGGGCTCGCAAACAAGCGGACCTCGAGAAGGAGGAACTGGCAGAGGAGCTGGCCAGTAGCCTGTCGGGAAGGAACGCACTCCAGGACGAGAAGCGCCGCCTGGAGGCCCGGATCGCCCAGCTGGAGGAGGAGCTGGAGGAGGAGCAGGGCAACATGGAGGCCATGAGCGACCGGGTCCGCAAAGCCACACAGCAGGCCGAGCAGCTCAGCAACGAGCTGGCCACAGAGCGCAGCACGGCCCAGAAGAATGAGAGTGCCCGGCAGCAGCTCGAGCGGCAGAACAAGGAGCTCCGGAGCAAGCTCCACGAGATGGAGGGGGCCGTCAAGTCCAAGTTCAAGTCCACCATCGCGGCGCTGGAGGCCAAGATTGCACAGCTGGAGGAGCAGGTCGAGCAGGAGGCCAGAGAGAAACAGGCGGCCACCAAGTCGCTGAAGCAGAAAGACAAGAAGCTGAAGGAAATCTTGCTGCAGGTGGAGGACGAGCGCAAGATGGCCGAGCAGTACAAGGAGCAGGCAGAGAAAGGCAATGCCAGGGTCAAGCAGCTCAAGAGGCAGCTGGAGGAGGCAGAGGAGGAGTCCCAGCGCATCAACGCCAACCGCAGGAAGCTGCAGCGGGAGCTGGATGAGGCCACGGAGAGCAACGAGGCCATGGGCCGCGAGGTGAACGCACTCAAGAGCAAGCTCAGGCGAGGAAACGAGACCTCTTTCGTTCCTTCTAGAAGGTCTGGAGGACGTAGAGTTATTGAAAATGCAGATGGTTCTGAGGAGGAAACGGACACTCGAGACGCAGACTTCAATGGAACCAAGGCCAGTGAATAAGCAACTTTCTACAGTTTTGCACCACGGCAAGAAAACCAAAAACCAAAACAAACAAACAAAAAAAACCCAACAACAACCCAGAACAAAGCAAAACCCAGCAGACTGTACTTAGCATTGTCTAAATCCATTCTCAAATTCCAAATATCACAGACACCCCTCACACAAGGAATATAAAAACCACCACCCTCCAGCCTGGGCAACGTAGTAAAACCTCATCTATACAAGAATTTAAAAATAAGCTGGGCGTGGTGGTACACACCTGTGGTCCCAGCTACTAGGGAGGCTGAGCCAGGAAGAACGCTCCAGCCCAGGACTTCGAGGCTGCAATGAGCTATAATTGCATCATTGCACTCCAGCCTGGGCAACAGAGACCCTGTCTCAACCACCACCACCACCACCACCCCTACTACCCCTGTATTCAAGGTAAAAATTGAAGTTTGTATGATGTAAGAGATGAGAAAAACCCAACAGGAAACACAGACACATCCTCCAGTTCTATCAATGGATTGTGCAGACACTGAGTTTTTAGAAAAACATATCCACGGTAACCGGTCCCTGGCAATTCTGTTTACATGAAATGGGGAGAAAGTCACCGAAATGGGTGCCGCCGGCCCCCACTCCCAATTCATTCCCTAACCTGCAAACCTTTCCAACTTCTCACGTCAGGCCTTTGAGAATTCTTTCCCCCTCTCCTGGTTTCCACACCTCAGACACGCACAGTTCACCAAGTGCCTTCTGTAGTCACATGAATTGAAAAGGAGACGCTGCTCCCACGGAGGGGAGCAGGAATGCTGCACTGTTTACACCCTGACTGTGCTTAAAAACACTTTCACTAATAAATGGTTAT