Transcript asmbl_55135

Sequence
Transcript Sequence for observation asmbl_55135 of TGE0059639:
AGGGTATCTGACAGCAATAGATTTATTAAGTATCCCCGAAAATATAAACACAAACCAGTAAAAAACAAAACCGTAAAACGTCAGGCCTGGAGCTGCAATAAGACAGAGACAGGAGCAGCTCACACGTGGCCTAGGTGGGGAGGACGAGGCCATAAATACTGCAGGAGGGCGGCAAGGGAGCCCTAGGGCGAGGGGAAAGCAGGGTGTCGGCAGCAAGATGGCTCCGGGGGTTTAGACACTGCTGGCTTCGGCCCCGGCCGCCACCTGCCTCTCACTCCAGCTGCGAGCAGCTTCACTTGGGGCCCTGGGCCTCCGACTCCTCCTCGTCGTCTTCGTACATCTCGCCCTCTTCCTCGGCCGTGGCGTCCTGGTACTGCTGGTACTCGGACACCAGGTCGTTCATGTTGCTCTCGGCCTCGGTGAACTCCATCTCGTCCATGCCCTCGCCCGTGTACCAGTGCAGGAAGGCCTTGCGCCGGAACATGGCCGTGAACTGCTCGGAGATGCGCTTGAACAGCTCCTGGATGGCCGTGCTGTTCCCGATGAAGGTGGAGGACATCTTGAGGCCGCGGGGCGGGATGTCACACACGGCCACCTTCACGTTGTTGGGGATCCACTCCACGAAGTAGCTGCTGTTCTTGCTCTGGATGGCCAGCATCTGCTCGTCCACCTCCTTCATGGACATGCGGCCCCGGAACACGGTGGCCACCGTCAGGTAGCGGCCGTGGCGCGGGTCGCAGGCGGCCATCATGTTCTTGGCATCGAACATCTGCTGGGTGAGCTCGGGCACGGTCAGGGCCCGGTACTGCTGGCTGCCCCGGGCTGTGAGGGGGGCGAAGCCGGGCATGAAGAAGTGCAGGCGCGGGAAGGGCACCATGTTGACGGCCAGCTTGCGCAGGTCAGCGTTGAGCTGGCCCGGGAAGCGCAAGGAGGTGGTGACTCCGCTCATGGTGGC